MD08G1151500.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
OG0001875
Physical Location & Seq
Forward (+)
15996772 .. 15997424
653 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1151500.v1.1.491

Sequence Viewer

Length: 357 bp
ATGGCATCTAGATTCGTGAACTTTCTCTGCTTGGTTTTCGTTTGCAGTCTCATTGTAGGAGGAAATTGCCAACCCTGCACGTTAGACAATCTTGAAATTGCACAAGGGAAGATTAGCGATGACAAGTGGAATGTAACAATTACTAATGACTGTCCATGTTCTCAACTGGATGTGAAGCTTAGTTGCGATGGATTTGATCAGTCTGCAGTTGATCCTTCAATTTTGTCAAAATCTGGTGGCGAGTGTTTGGTCAATAATGGTCAACCAATCTATGGAAATAAAATTTTCAATTTTGCCTATGCTTCGAAAACTGAGTTTCCTTTCAAGCCACTCTCCTCCCAAGTTGCTTGTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

12.74

Weight (kDa)

4.62

Isoelectric Point (pI)

42.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPD1_C PF24068 39 - 116 3.6e-22 Tapetum determinant 1, C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 272
AclWI GGATC 1 cut(s) 206
AcsI RAATTY 1 cut(s) 282
AfiI CCNNNNNNNGG 1 cut(s) 272
AgsI TTSAA 4 cut(s) 95, 219, 289, 325
AluBI AGCT 1 cut(s) 178
AluI AGCT 1 cut(s) 178
Alw26I GTCTC 1 cut(s) 53
AlwI GGATC 1 cut(s) 206
ApoI RAATTY 1 cut(s) 282
AsuII TTCGAA 1 cut(s) 305
BccI CCATC 1 cut(s) 182
BclI TGATCA 1 cut(s) 196
BcoDI GTCTC 1 cut(s) 53
BfaI CTAG 1 cut(s) 9
BfmI CTRYAG 1 cut(s) 204
BmsI GCATC 1 cut(s) 14
Bpu14I TTCGAA 1 cut(s) 305
Bsc4I CCNNNNNNNGG 1 cut(s) 272
Bse1I ACTGG 1 cut(s) 171
BseGI GGATG 1 cut(s) 175
BseLI CCNNNNNNNGG 1 cut(s) 272
BseMII CTCAG 1 cut(s) 303
BseNI ACTGG 1 cut(s) 171
BseRI GAGGAG 1 cut(s) 325
BsgI GTGCAG 1 cut(s) 61
BslI CCNNNNNNNGG 1 cut(s) 272
BsmAI GTCTC 1 cut(s) 53
Bsp119I TTCGAA 1 cut(s) 305
Bsp143I GATC 2 cut(s) 196, 211
BspCNI CTCAG 1 cut(s) 304
BspMAI CTGCAG 1 cut(s) 208
BspPI GGATC 1 cut(s) 206
BspT104I TTCGAA 1 cut(s) 305
BsrI ACTGG 1 cut(s) 171
BssMI GATC 2 cut(s) 196, 211
Bst4CI ACNGT 1 cut(s) 152
BstBI TTCGAA 1 cut(s) 305
BstDEI CTNAG 2 cut(s) 179, 312
BstF5I GGATG 1 cut(s) 175
BstKTI GATC 2 cut(s) 199, 214
BstMAI GTCTC 1 cut(s) 53
BstMBI GATC 2 cut(s) 196, 211
BstMWI GCNNNNNNNGC 1 cut(s) 75
BstSFI CTRYAG 1 cut(s) 204
BtgZI GCGATG 2 cut(s) 132, 201
BtsCI GGATG 1 cut(s) 175
CviAII CATG 1 cut(s) 156
CviJI RGCY 2 cut(s) 178, 328
CviKI_1 RGCY 2 cut(s) 178, 328
DdeI CTNAG 2 cut(s) 179, 312
DpnI GATC 2 cut(s) 198, 213
DpnII GATC 2 cut(s) 196, 211
FaeI CATG 1 cut(s) 159
FaiI YATR 3 cut(s) 157, 273, 300
FatI CATG 1 cut(s) 155
FbaI TGATCA 1 cut(s) 196
FokI GGATG 1 cut(s) 182
FspBI CTAG 1 cut(s) 9
Hin1II CATG 1 cut(s) 159
HincII GTYRAC 1 cut(s) 263
HindII GTYRAC 1 cut(s) 263
HindIII AAGCTT 1 cut(s) 176
HinfI GANTC 1 cut(s) 12
Hpy166II GTNNAC 2 cut(s) 19, 263
Hpy188III TCNNGA 4 cut(s) 9, 16, 92, 354
Hpy8I GTNNAC 2 cut(s) 19, 263
HpyAV CCTTC 1 cut(s) 225
HpyCH4III ACNGT 1 cut(s) 152
HpyCH4IV ACGT 1 cut(s) 80
HpyCH4V TGCA 4 cut(s) 45, 78, 101, 206
HpyF10VI GCNNNNNNNGC 1 cut(s) 75
HpyF3I CTNAG 2 cut(s) 179, 312
HpySE526I ACGT 1 cut(s) 80
Hsp92II CATG 1 cut(s) 159
Ksp22I TGATCA 1 cut(s) 196
Kzo9I GATC 2 cut(s) 196, 211
LpnPI CCDG 3 cut(s) 88, 152, 219
LweI GCATC 1 cut(s) 14
MaeI CTAG 1 cut(s) 9
MaeII ACGT 1 cut(s) 80
MaeIII GTNAC 1 cut(s) 133
MalI GATC 2 cut(s) 198, 213
MboI GATC 2 cut(s) 196, 211
MboII GAAGA 1 cut(s) 121
MluCI AATT 6 cut(s) 64, 96, 138, 219, 282, 289
MnlI CCTC 2 cut(s) 53, 346
MwoI GCNNNNNNNGC 1 cut(s) 75
NdeII GATC 2 cut(s) 196, 211
NlaIII CATG 1 cut(s) 159
NspV TTCGAA 1 cut(s) 305
PfeI GAWTC 1 cut(s) 12
PflMI CCANNNNNTGG 1 cut(s) 272
PstI CTGCAG 1 cut(s) 208
Sau3AI GATC 2 cut(s) 196, 211
SetI ASST 2 cut(s) 83, 180
SfaNI GCATC 1 cut(s) 14
SfcI CTRYAG 1 cut(s) 204
SfuI TTCGAA 1 cut(s) 305
Sse9I AATT 6 cut(s) 64, 96, 138, 219, 282, 289
SspMI CTAG 1 cut(s) 9
TaaI ACNGT 1 cut(s) 152
TaiI ACGT 1 cut(s) 83
TaqI TCGA 1 cut(s) 305
TasI AATT 6 cut(s) 64, 96, 138, 219, 282, 289
TfiI GAWTC 1 cut(s) 12
Van91I CCANNNNNTGG 1 cut(s) 272
XapI RAATTY 1 cut(s) 282
XbaI TCTAGA 1 cut(s) 8
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.