Rroxscaffold_7G00170440

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0001875
Physical Location & Seq
Forward (+)
10891338 .. 10891794
457 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00170440.1

Sequence Viewer

Length: 336 bp
ATGGGAGGCGAGTCTCAACATTGCAACCTAAATAATCTCAAAATTACACAATCAACAACTGGAAAGTCTGTTCAAAGTCGACCAGAGTGGAAAGTAACAATCACGAATGACTGCTCATGTACTCAACTCAATGTTAAGATTAGTTCTCCTGGGTTTCAAACTGTGGAGCCAATGGCATCTTCAATCTTGAGCAAATCTGGTAACGACTATCTTGTTAATAGTGGTAAACCTATCTATGCGTATGAGAATTTCAGTTTCACCTATGCTTGGGCCACTCAGTTTACTTTCAAACCATCAGACTCCACAGTTGCTTGTTCAGCTGAAGGAAAGTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.15

Weight (kDa)

7.63

Isoelectric Point (pI)

37.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPD1_C PF24068 11 - 105 8.7e-28 Tapetum determinant 1, C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 79
AcsI RAATTY 1 cut(s) 247
AfaI GTAC 1 cut(s) 121
AfiI CCNNNNNNNGG 1 cut(s) 267
AgsI TTSAA 4 cut(s) 74, 158, 183, 289
AjnI CCWGG 1 cut(s) 148
AjuI GAANNNNNNNTTGG 2 cut(s) 163, 195
AloI GAACNNNNNNTCC 2 cut(s) 54, 86
AluBI AGCT 1 cut(s) 320
AluI AGCT 1 cut(s) 320
Alw26I GTCTC 1 cut(s) 18
AoxI GGCC 1 cut(s) 270
ApoI RAATTY 1 cut(s) 247
AspS9I GGNCC 1 cut(s) 270
AsuHPI GGTGA 1 cut(s) 250
BccI CCATC 1 cut(s) 301
BciT130I CCWGG 1 cut(s) 150
BcoDI GTCTC 1 cut(s) 18
Bme1390I CCNGG 1 cut(s) 150
BmgT120I GGNCC 1 cut(s) 270
BmiI GGNNCC 1 cut(s) 168
BmrFI CCNGG 1 cut(s) 150
BmsI GCATC 1 cut(s) 185
BpuEI CTTGAG 1 cut(s) 208
BsaJI CCNNGG 1 cut(s) 149
Bsc4I CCNNNNNNNGG 1 cut(s) 267
Bse1I ACTGG 1 cut(s) 64
Bse3DI GCAATG 1 cut(s) 19
BseBI CCWGG 1 cut(s) 150
BseDI CCNNGG 1 cut(s) 149
BseLI CCNNNNNNNGG 1 cut(s) 267
BseMI GCAATG 1 cut(s) 19
BseMII CTCAG 1 cut(s) 290
BseNI ACTGG 1 cut(s) 64
BshFI GGCC 1 cut(s) 272
BslI CCNNNNNNNGG 1 cut(s) 267
BsmAI GTCTC 1 cut(s) 18
BsnI GGCC 1 cut(s) 272
BspANI GGCC 1 cut(s) 272
BspCNI CTCAG 1 cut(s) 289
BspLI GGNNCC 1 cut(s) 168
BsrDI GCAATG 1 cut(s) 19
BsrI ACTGG 1 cut(s) 64
BssECI CCNNGG 1 cut(s) 149
Bst2UI CCWGG 1 cut(s) 150
Bst4CI ACNGT 2 cut(s) 163, 307
BstDEI CTNAG 1 cut(s) 276
BstMAI GTCTC 1 cut(s) 18
BstMWI GCNNNNNNNGC 1 cut(s) 317
BstNI CCWGG 1 cut(s) 150
BstSCI CCNGG 1 cut(s) 148
BsuRI GGCC 1 cut(s) 272
Cfr13I GGNCC 1 cut(s) 270
Csp6I GTAC 1 cut(s) 120
CviAII CATG 1 cut(s) 117
CviJI RGCY 3 cut(s) 169, 272, 320
CviKI_1 RGCY 3 cut(s) 169, 272, 320
CviQI GTAC 1 cut(s) 120
DdeI CTNAG 1 cut(s) 276
EcoRII CCWGG 1 cut(s) 148
FaeI CATG 1 cut(s) 120
FaiI YATR 4 cut(s) 118, 237, 243, 264
FatI CATG 1 cut(s) 116
FblI GTMKAC 1 cut(s) 79
HaeIII GGCC 1 cut(s) 272
Hin1II CATG 1 cut(s) 120
HincII GTYRAC 1 cut(s) 80
HindII GTYRAC 1 cut(s) 80
HinfI GANTC 2 cut(s) 11, 299
HphI GGTGA 1 cut(s) 250
Hpy166II GTNNAC 3 cut(s) 80, 227, 282
Hpy188I TCNGA 1 cut(s) 298
Hpy188III TCNNGA 2 cut(s) 103, 187
Hpy8I GTNNAC 3 cut(s) 80, 227, 282
HpyAV CCTTC 1 cut(s) 317
HpyCH4III ACNGT 2 cut(s) 163, 307
HpyCH4V TGCA 1 cut(s) 24
HpyF10VI GCNNNNNNNGC 1 cut(s) 317
HpyF3I CTNAG 1 cut(s) 276
Hsp92II CATG 1 cut(s) 120
LmnI GCTCC 1 cut(s) 166
LpnPI CCDG 5 cut(s) 45, 96, 135, 162, 183
LweI GCATC 1 cut(s) 185
MaeIII GTNAC 2 cut(s) 94, 200
MboII GAAGA 1 cut(s) 171
MluCI AATT 2 cut(s) 42, 247
MlyI GAGTC 2 cut(s) 20, 293
MseI TTAA 2 cut(s) 135, 216
MspA1I CMGCKG 1 cut(s) 320
MspR9I CCNGG 1 cut(s) 150
MvaI CCWGG 1 cut(s) 150
MwoI GCNNNNNNNGC 1 cut(s) 317
NlaIII CATG 1 cut(s) 120
NlaIV GGNNCC 1 cut(s) 168
PleI GAGTC 2 cut(s) 19, 293
PpsI GAGTC 2 cut(s) 19, 293
Psp6I CCWGG 1 cut(s) 148
PspGI CCWGG 1 cut(s) 148
PspN4I GGNNCC 1 cut(s) 168
PspPI GGNCC 1 cut(s) 270
PvuII CAGCTG 1 cut(s) 320
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
SalI GTCGAC 1 cut(s) 78
SaqAI TTAA 2 cut(s) 135, 216
Sau96I GGNCC 1 cut(s) 270
SchI GAGTC 2 cut(s) 20, 293
ScrFI CCNGG 1 cut(s) 150
SetI ASST 4 cut(s) 30, 232, 263, 322
SfaNI GCATC 1 cut(s) 185
SmlI CTYRAG 1 cut(s) 187
SmoI CTYRAG 1 cut(s) 187
Sse9I AATT 2 cut(s) 42, 247
StyD4I CCNGG 1 cut(s) 148
TaaI ACNGT 2 cut(s) 163, 307
TaqI TCGA 1 cut(s) 79
TasI AATT 2 cut(s) 42, 247
TatI WGTACW 1 cut(s) 119
Tru1I TTAA 2 cut(s) 135, 216
Tru9I TTAA 2 cut(s) 135, 216
XapI RAATTY 1 cut(s) 247
XmiI GTMKAC 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.