Rmu_sc0008467.1_g000015

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008467.1
Physical Location & Seq
Forward (+)
59773 .. 62391
2619 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008467.1_g000015.1.cds

Sequence Viewer

Length: 627 bp
atgcagcagcagcagctatacatcatgaagcggtttctctgtgcagttttcctcttcggtctcaatgttggaggccagtgctttggttgctctgtgaaggatatctcaattgaacaatctcatacgggaaagtcggtccaaaacaagccagaatggaatgtgacgatcgcgaatggttgctcgtgttctcaactgaatgttaaactaggctgcgatggatttcaaactgttgaagacattgatccttccattttaagtgtatctggtggtgagtgtctggtcaagaatggtcaacctgtctatgccaatggaggccagtgctttggttgctctgtgaaggatatctcaattgaacaatctcggacgggaaagtcggtccaaaacaagccagaatggaatgtgacgatcgtgaatggttgctcgtgttctcaactgaatgttaaactaggctgcgatggatttcaaactgttgaagacattgatccttccattttaagtgtatctggtggtgagtgtctggtcaagaatggtcaacctgtctatgccaatggaggtttcaacttcatctatgcttgggacacttcattttctttcaatccaatctcctcccaaattgcttgctcctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

208

Amino Acids

22.33

Weight (kDa)

4.93

Isoelectric Point (pI)

47.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 370
AccII CGCG 1 cut(s) 170
AciI CCGC 1 cut(s) 31
AclWI GGATC 2 cut(s) 236, 476
AgsI TTSAA 8 cut(s) 113, 224, 233, 353, 464, 473, 559, 595
AjuI GAANNNNNNNTTGG 2 cut(s) 539, 571
AluBI AGCT 1 cut(s) 16
AluI AGCT 1 cut(s) 16
Alw26I GTCTC 1 cut(s) 65
AlwI GGATC 2 cut(s) 236, 476
AoxI GGCC 2 cut(s) 73, 313
ApeKI GCWGC 6 cut(s) 4, 7, 10, 13, 210, 450
AspS9I GGNCC 2 cut(s) 136, 376
AsuHPI GGTGA 2 cut(s) 281, 521
AvaII GGWCC 2 cut(s) 136, 376
BauI CACGAG 2 cut(s) 181, 421
BbsI GAAGAC 2 cut(s) 240, 480
BbvI GCAGC 6 cut(s) 16, 19, 22, 25, 197, 437
BccI CCATC 2 cut(s) 209, 449
BcoDI GTCTC 1 cut(s) 65
BfaI CTAG 2 cut(s) 206, 446
BisI GCNGC 6 cut(s) 5, 8, 11, 14, 211, 451
BlsI GCNGC 6 cut(s) 6, 9, 12, 15, 212, 452
Bme18I GGWCC 2 cut(s) 136, 376
BmgT120I GGNCC 2 cut(s) 136, 376
BpiI GAAGAC 2 cut(s) 240, 480
BsaI GGTCTC 1 cut(s) 65
Bse1I ACTGG 2 cut(s) 76, 316
BseNI ACTGG 2 cut(s) 76, 316
BseRI GAGGAG 1 cut(s) 595
BseXI GCAGC 6 cut(s) 16, 19, 22, 25, 197, 437
BsgI GTGCAG 1 cut(s) 63
Bsh1236I CGCG 1 cut(s) 170
Bsh1285I CGRYCG 2 cut(s) 168, 408
BshFI GGCC 2 cut(s) 75, 315
BsiEI CGRYCG 2 cut(s) 168, 408
BslFI GGGAC 1 cut(s) 590
BsmAI GTCTC 1 cut(s) 65
BsmFI GGGAC 1 cut(s) 590
BsnI GGCC 2 cut(s) 75, 315
Bso31I GGTCTC 1 cut(s) 65
Bsp143I GATC 4 cut(s) 165, 241, 405, 481
Bsp68I TCGCGA 1 cut(s) 170
BspACI CCGC 1 cut(s) 31
BspANI GGCC 2 cut(s) 75, 315
BspFNI CGCG 1 cut(s) 170
BspHI TCATGA 1 cut(s) 24
BspPI GGATC 2 cut(s) 236, 476
BspTNI GGTCTC 1 cut(s) 65
BsrI ACTGG 2 cut(s) 76, 316
BssMI GATC 4 cut(s) 165, 241, 405, 481
BssSI CACGAG 2 cut(s) 181, 421
Bst2BI CACGAG 2 cut(s) 181, 421
Bst4CI ACNGT 2 cut(s) 229, 469
Bst6I CTCTTC 1 cut(s) 59
BstC8I GCNNGC 1 cut(s) 619
BstFNI CGCG 1 cut(s) 170
BstKTI GATC 4 cut(s) 168, 244, 408, 484
BstMAI GTCTC 1 cut(s) 65
BstMBI GATC 4 cut(s) 165, 241, 405, 481
BstMCI CGRYCG 2 cut(s) 168, 408
BstMWI GCNNNNNNNGC 4 cut(s) 10, 13, 87, 327
BstUI CGCG 1 cut(s) 170
BstV1I GCAGC 6 cut(s) 16, 19, 22, 25, 197, 437
BstV2I GAAGAC 2 cut(s) 240, 480
BstXI CCANNNNNNTGG 2 cut(s) 83, 323
BsuRI GGCC 2 cut(s) 75, 315
BtgZI GCGATG 2 cut(s) 228, 468
BtsIMutI CAGTG 2 cut(s) 83, 323
BtuMI TCGCGA 1 cut(s) 170
Cac8I GCNNGC 1 cut(s) 619
CciI TCATGA 1 cut(s) 24
Cfr13I GGNCC 2 cut(s) 136, 376
CviAII CATG 1 cut(s) 25
CviJI RGCY 7 cut(s) 16, 75, 148, 210, 315, 388, 450
CviKI_1 RGCY 7 cut(s) 16, 75, 148, 210, 315, 388, 450
DpnI GATC 4 cut(s) 167, 243, 407, 483
DpnII GATC 4 cut(s) 165, 241, 405, 481
DrdI GACNNNNNNGTC 1 cut(s) 370
DseDI GACNNNNNNGTC 1 cut(s) 370
Eam1104I CTCTTC 1 cut(s) 59
EarI CTCTTC 1 cut(s) 59
Eco31I GGTCTC 1 cut(s) 65
Eco32I GATATC 2 cut(s) 103, 343
Eco47I GGWCC 2 cut(s) 136, 376
EcoRV GATATC 2 cut(s) 103, 343
FaeI CATG 1 cut(s) 28
FaiI YATR 6 cut(s) 19, 26, 123, 303, 543, 570
FaqI GGGAC 1 cut(s) 590
FatI CATG 1 cut(s) 24
Fnu4HI GCNGC 6 cut(s) 5, 8, 11, 14, 211, 451
Fsp4HI GCNGC 6 cut(s) 5, 8, 11, 14, 211, 451
FspBI CTAG 2 cut(s) 206, 446
GluI GCNGC 6 cut(s) 5, 8, 11, 14, 211, 451
HaeIII GGCC 2 cut(s) 75, 315
Hin1II CATG 1 cut(s) 28
HincII GTYRAC 2 cut(s) 293, 533
HindII GTYRAC 2 cut(s) 293, 533
HphI GGTGA 2 cut(s) 281, 521
Hpy166II GTNNAC 2 cut(s) 293, 533
Hpy188I TCNGA 1 cut(s) 363
Hpy188III TCNNGA 5 cut(s) 25, 169, 283, 409, 523
Hpy8I GTNNAC 2 cut(s) 293, 533
HpyAV CCTTC 4 cut(s) 91, 255, 331, 495
HpyCH4III ACNGT 2 cut(s) 229, 469
HpyCH4V TGCA 2 cut(s) 4, 44
HpyF10VI GCNNNNNNNGC 4 cut(s) 10, 13, 87, 327
Hsp92II CATG 1 cut(s) 28
Kzo9I GATC 4 cut(s) 165, 241, 405, 481
LmnI GCTCC 1 cut(s) 626
Lsp1109I GCAGC 6 cut(s) 16, 19, 22, 25, 197, 437
MaeI CTAG 2 cut(s) 206, 446
MaeIII GTNAC 2 cut(s) 160, 400
MalI GATC 4 cut(s) 167, 243, 407, 483
MboI GATC 4 cut(s) 165, 241, 405, 481
MboII GAAGA 3 cut(s) 46, 245, 485
MfeI CAATTG 2 cut(s) 108, 348
MluCI AATT 3 cut(s) 108, 348, 612
MmeI TCCRAC 1 cut(s) 49
MnlI CCTC 5 cut(s) 62, 65, 305, 545, 616
MseI TTAA 4 cut(s) 201, 254, 441, 494
MunI CAATTG 2 cut(s) 108, 348
MvnI CGCG 1 cut(s) 170
MwoI GCNNNNNNNGC 4 cut(s) 10, 13, 87, 327
NdeII GATC 4 cut(s) 165, 241, 405, 481
NlaIII CATG 1 cut(s) 28
NmuCI GTSAC 2 cut(s) 160, 400
NruI TCGCGA 1 cut(s) 170
PagI TCATGA 1 cut(s) 24
PkrI GCNGC 6 cut(s) 6, 9, 12, 15, 212, 452
Ple19I CGATCG 2 cut(s) 168, 408
PspPI GGNCC 2 cut(s) 136, 376
PvuI CGATCG 2 cut(s) 168, 408
RruI TCGCGA 1 cut(s) 170
SaqAI TTAA 4 cut(s) 201, 254, 441, 494
SatI GCNGC 6 cut(s) 5, 8, 11, 14, 211, 451
Sau3AI GATC 4 cut(s) 165, 241, 405, 481
Sau96I GGNCC 2 cut(s) 136, 376
SetI ASST 4 cut(s) 18, 298, 538, 556
SinI GGWCC 2 cut(s) 136, 376
Sse9I AATT 3 cut(s) 108, 348, 612
SsiI CCGC 1 cut(s) 31
SspMI CTAG 2 cut(s) 206, 446
TaaI ACNGT 2 cut(s) 229, 469
TaqII GACCGA 3 cut(s) 47, 124, 364
TasI AATT 3 cut(s) 108, 348, 612
Tru1I TTAA 4 cut(s) 201, 254, 441, 494
Tru9I TTAA 4 cut(s) 201, 254, 441, 494
TscAI CASTG 2 cut(s) 83, 323
TseFI GTSAC 2 cut(s) 160, 400
TseI GCWGC 6 cut(s) 4, 7, 10, 13, 210, 450
Tsp45I GTSAC 2 cut(s) 160, 400
TspDTI ATGAA 3 cut(s) 41, 553, 573
TspRI CASTG 2 cut(s) 83, 323
VpaK11BI GGWCC 2 cut(s) 136, 376
XspI CTAG 2 cut(s) 206, 446
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.