MD14G1197700.v1.1

Belongs to the universal ribosomal protein uS4 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0001270
Physical Location & Seq
Reverse (-)
28785591 .. 28785755
165 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1197700.v1.1.491

Sequence Viewer

Length: 165 bp
ATGGTGAAAATTTTAAATGGCAAGACGCTTAAGAAGCCCCGCCGCCCCTACAAGAAGGAACGGTTGGATGCTGAGCTGAAGCTCGTGGGTGAGTTCGGGCTTCGGTCCAAGAGAGTTGTGGAGGGTTTCAGCATCTCAAAGCCGTATCCGAAACAATGCCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
S4

Protein Analysis

55

Amino Acids

6.29

Weight (kDa)

10.29

Isoelectric Point (pI)

30.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 40, 43
AcsI RAATTY 1 cut(s) 9
AcuI CTGAAG 1 cut(s) 98
AflII CTTAAG 1 cut(s) 29
AjuI GAANNNNNNNTTGG 2 cut(s) 47, 79
AluBI AGCT 2 cut(s) 76, 82
AluI AGCT 2 cut(s) 76, 82
ApoI RAATTY 1 cut(s) 9
AspS9I GGNCC 1 cut(s) 105
AsuHPI GGTGA 2 cut(s) 16, 101
AvaII GGWCC 1 cut(s) 105
BauI CACGAG 1 cut(s) 83
BceAI ACGGC 1 cut(s) 127
BciVI GTATCC 1 cut(s) 156
BfrI CTTAAG 1 cut(s) 29
BfuI GTATCC 1 cut(s) 156
BisI GCNGC 1 cut(s) 43
BlpI GCTNAGC 1 cut(s) 72
BlsI GCNGC 1 cut(s) 44
Bme18I GGWCC 1 cut(s) 105
BmgT120I GGNCC 1 cut(s) 105
BmsI GCATC 2 cut(s) 58, 141
Bpu1102I GCTNAGC 1 cut(s) 72
BseGI GGATG 1 cut(s) 73
BseMII CTCAG 1 cut(s) 63
Bsp1720I GCTNAGC 1 cut(s) 72
BspACI CCGC 2 cut(s) 40, 43
BspCNI CTCAG 1 cut(s) 64
BspTI CTTAAG 1 cut(s) 29
BssSI CACGAG 1 cut(s) 83
Bst2BI CACGAG 1 cut(s) 83
Bst4CI ACNGT 1 cut(s) 63
BstAFI CTTAAG 1 cut(s) 29
BstDEI CTNAG 1 cut(s) 72
BstF5I GGATG 1 cut(s) 73
BstMWI GCNNNNNNNGC 1 cut(s) 34
BsuI GTATCC 1 cut(s) 156
BtsCI GGATG 1 cut(s) 73
Cfr13I GGNCC 1 cut(s) 105
CseI GACGC 1 cut(s) 34
CviJI RGCY 5 cut(s) 37, 76, 82, 100, 142
CviKI_1 RGCY 5 cut(s) 37, 76, 82, 100, 142
DdeI CTNAG 1 cut(s) 72
DraI TTTAAA 1 cut(s) 15
Eco47I GGWCC 1 cut(s) 105
Eco57I CTGAAG 1 cut(s) 98
FauI CCCGC 1 cut(s) 47
Fnu4HI GCNGC 1 cut(s) 43
FokI GGATG 1 cut(s) 80
Fsp4HI GCNGC 1 cut(s) 43
GluI GCNGC 1 cut(s) 43
HgaI GACGC 1 cut(s) 34
HphI GGTGA 2 cut(s) 16, 101
Hpy188I TCNGA 1 cut(s) 150
HpyAV CCTTC 1 cut(s) 49
HpyCH4III ACNGT 1 cut(s) 63
HpyF10VI GCNNNNNNNGC 1 cut(s) 34
HpyF3I CTNAG 1 cut(s) 72
LweI GCATC 2 cut(s) 58, 141
MluCI AATT 1 cut(s) 9
MmeI TCCRAC 1 cut(s) 45
MnlI CCTC 1 cut(s) 115
MseI TTAA 2 cut(s) 14, 30
MspCI CTTAAG 1 cut(s) 29
MwoI GCNNNNNNNGC 1 cut(s) 34
PkrI GCNGC 1 cut(s) 44
PspPI GGNCC 1 cut(s) 105
SaqAI TTAA 2 cut(s) 14, 30
SatI GCNGC 1 cut(s) 43
Sau96I GGNCC 1 cut(s) 105
SetI ASST 2 cut(s) 78, 84
SfaNI GCATC 2 cut(s) 58, 141
SgeI CNNG 7 cut(s) 34, 51, 64, 95, 97, 109, 121
SinI GGWCC 1 cut(s) 105
SmlI CTYRAG 1 cut(s) 29
SmoI CTYRAG 1 cut(s) 29
Sse9I AATT 1 cut(s) 9
SsiI CCGC 2 cut(s) 40, 43
TaaI ACNGT 1 cut(s) 63
TaqII GACCGA 1 cut(s) 93
TasI AATT 1 cut(s) 9
TauI GCSGC 1 cut(s) 45
Tru1I TTAA 2 cut(s) 14, 30
Tru9I TTAA 2 cut(s) 14, 30
Vha464I CTTAAG 1 cut(s) 29
VpaK11BI GGWCC 1 cut(s) 105
XapI RAATTY 1 cut(s) 9
XcmI CCANNNNNNNNNTGG 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.