RchiOBHm_Chr6g0256021

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0001270
Physical Location & Seq
Reverse (-)
11411533 .. 11412586
1054 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22964

Sequence Viewer

Length: 150 bp
ATGCAACTCGTGGATCTGGAGATAATGAAAATCCAGATGGTCTCGGAGGAGATTAGCCATCGCTCGAGGAGCAGAGCACCTCGTCACTCCTCCGCTATCTCCTCAACCCTCGACAAGCTCAAGAATGTAGGTATTGTTTTACTTCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.56

Weight (kDa)

9.69

Isoelectric Point (pI)

51.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 93
AclWI GGATC 1 cut(s) 21
AluBI AGCT 1 cut(s) 118
AluI AGCT 1 cut(s) 118
Alw21I GWGCWC 1 cut(s) 79
Alw26I GTCTC 1 cut(s) 46
AlwI GGATC 1 cut(s) 21
Ama87I CYCGRG 1 cut(s) 64
AvaI CYCGRG 1 cut(s) 64
BauI CACGAG 1 cut(s) 8
Bbv12I GWGCWC 1 cut(s) 79
BccI CCATC 2 cut(s) 31, 66
BcoDI GTCTC 1 cut(s) 46
BmeT110I CYCGRG 1 cut(s) 64
BpmI CTGGAG 1 cut(s) 38
BpuEI CTTGAG 1 cut(s) 104
BsaI GGTCTC 1 cut(s) 46
BseRI GAGGAG 4 cut(s) 62, 79, 82, 91
BsiHKAI GWGCWC 1 cut(s) 79
BsiHKCI CYCGRG 1 cut(s) 64
BsmAI GTCTC 1 cut(s) 46
Bso31I GGTCTC 1 cut(s) 46
BsoBI CYCGRG 1 cut(s) 64
Bsp1286I GDGCHC 1 cut(s) 79
Bsp143I GATC 1 cut(s) 13
BspACI CCGC 1 cut(s) 93
BspPI GGATC 1 cut(s) 21
BspTNI GGTCTC 1 cut(s) 46
BssMI GATC 1 cut(s) 13
BssSI CACGAG 1 cut(s) 8
Bst2BI CACGAG 1 cut(s) 8
BstKTI GATC 1 cut(s) 16
BstMAI GTCTC 1 cut(s) 46
BstMBI GATC 1 cut(s) 13
BstMWI GCNNNNNNNGC 1 cut(s) 69
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BtgZI GCGATG 1 cut(s) 44
BtsIMutI CAGTG 1 cut(s) 145
CviJI RGCY 2 cut(s) 57, 118
CviKI_1 RGCY 2 cut(s) 57, 118
DpnI GATC 1 cut(s) 15
DpnII GATC 1 cut(s) 13
Eco31I GGTCTC 1 cut(s) 46
Eco88I CYCGRG 1 cut(s) 64
GsuI CTGGAG 1 cut(s) 38
Hpy188I TCNGA 1 cut(s) 46
Hpy188III TCNNGA 3 cut(s) 17, 34, 121
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 69
Kzo9I GATC 1 cut(s) 13
LmnI GCTCC 1 cut(s) 69
LpnPI CCDG 2 cut(s) 2, 47
MaeIII GTNAC 1 cut(s) 83
MalI GATC 1 cut(s) 15
MboI GATC 1 cut(s) 13
MflI RGATCY 1 cut(s) 13
MhlI GDGCHC 1 cut(s) 79
MnlI CCTC 6 cut(s) 40, 60, 90, 100, 112, 119
MwoI GCNNNNNNNGC 1 cut(s) 69
NdeII GATC 1 cut(s) 13
NmuCI GTSAC 1 cut(s) 83
PaeR7I CTCGAG 1 cut(s) 64
PspXI VCTCGAGB 1 cut(s) 64
PsuI RGATCY 1 cut(s) 13
Sau3AI GATC 1 cut(s) 13
SduI GDGCHC 1 cut(s) 79
SetI ASST 3 cut(s) 82, 120, 133
Sfr274I CTCGAG 1 cut(s) 64
SlaI CTCGAG 1 cut(s) 64
SmlI CTYRAG 2 cut(s) 64, 119
SmoI CTYRAG 2 cut(s) 64, 119
SsiI CCGC 1 cut(s) 93
TaqI TCGA 2 cut(s) 65, 111
TseFI GTSAC 1 cut(s) 83
Tsp45I GTSAC 1 cut(s) 83
TspDTI ATGAA 1 cut(s) 41
XhoI CTCGAG 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.