MD16G1160500.v1.1

Major allergen Pru

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
OG0000091
Physical Location & Seq
Reverse (-)
13069155 .. 13070015
861 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1160500.v1.1.491

Sequence Viewer

Length: 480 bp
ATGGGTGTCCTCACATACGAAACCGAATATGCCTCAGTCATCCCCCCTGCTAGGTTGTACAATGCCCTTGTTCTTGATGCTGACAATCTCATTCCGAAGATTGCTCCACAAGCAGTCAAAACTGTTGAAATTCTCGAGGGAGATGGCGGTGTTGGAACCATCAAGAAAGTTAGCTTTGGTGAAGGGAGTGAATACAGCTATGTGAAGCACAAGGTTGAGGGAATTGACAAAGATAACTTTGACTATAGCTATAGCTTGATTGAAGGGGATGCCATTTCTGACAAAATTGAGAAGATCTCTTATGAAATTAAGTTGGTGGCATCTGGCAGTGGTTCCATCATCAAGAACACCAGCCACTACCACACTAAGGGAGATGTTGAGATCAAAGAAGAACATGTTAAGGTTGGAAAAGACAAGGCCCATGGTCTGTTCAAGCTTATTGAGAACTACCTTGTGGCCAATCCTGATGCCTACAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Bet_v_1

Protein Analysis

160

Amino Acids

17.45

Weight (kDa)

5.22

Isoelectric Point (pI)

21.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Bet_v_1 PF00407 1 - 153 8.6e-23 Pathogenesis-related protein Bet v 1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000091)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g18830 FvH4_4g18850 FvH4_4g18851 FvH4_4g18990 FvH4_4g19000 FvH4_4g19010 FvH4_4g19020 FvH4_4g19040 FvH4_4g19050 FvH4_4g19060 FvH4_4g19080 FvH4_4g19120 FvH4_4g19170 FvH4_4g19700 FvH4_4g19710 FvH4_5g00780
malus_domestica MD13G1160600.v1.1 MD13G1160700.v1.1 MD13G1160900.v1.1 MD13G1161000.v1.1 MD13G1161100.v1.1 MD13G1161200.v1.1 MD13G1161300.v1.1 MD13G1161400.v1.1 MD16G1159900.v1.1 MD16G1160000.v1.1 MD16G1160100.v1.1 MD16G1160300.v1.1 MD16G1160400.v1.1 MD16G1160500.v1.1 MD16G1160700.v1.1 MD16G1161100.v1.1 MD16G1161200.v1.1 MD16G1161400.v1.1 MD16G1161500.v1.1
prunus_persica Prupe.1G126900_v2.0.a1 Prupe.1G126900_v2.0.a1 Prupe.1G127100_v2.0.a1 Prupe.1G127200_v2.0.a1 Prupe.1G127300_v2.0.a1 Prupe.1G127400_v2.0.a1 Prupe.1G127500_v2.0.a1 Prupe.1G127600_v2.0.a1 Prupe.1G127600_v2.0.a1 Prupe.1G127700_v2.0.a1 Prupe.1G127800_v2.0.a1 Prupe.1G127900_v2.0.a1 Prupe.1G128100_v2.0.a1 Prupe.1G128200_v2.0.a1 Prupe.1G128300_v2.0.a1 Prupe.1G128500_v2.0.a1 Prupe.1G128600_v2.0.a1 Prupe.1G128700_v2.0.a1 Prupe.6G094400_v2.0.a1
pyrus_communis pycom06g07350 pycom08g13110 pycom08g13120 pycom13g13660 pycom13g13680 pycom13g13700 pycom13g13710 pycom13g13730 pycom13g13740 pycom13g13750 pycom13g13760 pycom16g13470 pycom16g13480 pycom16g13540 pycom16g13580 pycom16g13600 pycom16g13650 pycom16g13690
rosa_chinensis RchiOBHm_Chr4g0410071 RchiOBHm_Chr4g0410081 RchiOBHm_Chr4g0410091 RchiOBHm_Chr4g0410251 RchiOBHm_Chr4g0410281 RchiOBHm_Chr4g0410291 RchiOBHm_Chr4g0423641 RchiOBHm_Chr4g0423661 RchiOBHm_Chr4g0423691 RchiOBHm_Chr4g0423701 RchiOBHm_Chr4g0423711 RchiOBHm_Chr4g0423721 RchiOBHm_Chr4g0423881 RchiOBHm_Chr4g0423891 RchiOBHm_Chr4g0423901 RchiOBHm_Chr4g0423911 RchiOBHm_Chr4g0423921 RchiOBHm_Chr4g0423931 RchiOBHm_Chr4g0423941 RchiOBHm_Chr4g0423961 RchiOBHm_Chr4g0423971 RchiOBHm_Chr4g0423991 RchiOBHm_Chr4g0424011 RchiOBHm_Chr4g0424021 RchiOBHm_Chr4g0424031 RchiOBHm_Chr4g0424041 RchiOBHm_Chr4g0424121 RchiOBHm_Chr4g0424131 RchiOBHm_Chr4g0425171 RchiOBHm_Chr4g0425181 RchiOBHm_Chr7g0201401
rosa_laevigata RLG00000003678 RLG00000007393 RLG00000007394 RLG00000007502 RLG00000007503 RLG00000007508 RLG00000007509 RLG00000007510 RLG00000007511 RLG00000007512 RLG00000007514 RLG00000007515 RLG00000007516 RLG00000007517 RLG00000007518 RLG00000007520 RLG00000007521 RLG00000007523 RLG00000007535 RLG00000007536 RLG00000007537 RLG00000007538 RLG00000007539 RLG00000008440 RLG00000008441 RLG00000008491 RLG00000008504
rosa_multiflora Rmu_co8215346.1_g000001 Rmu_sc0000365.1_g000047 Rmu_sc0000365.1_g000054 Rmu_sc0000365.1_g000055 Rmu_sc0000464.1_g000004 Rmu_sc0000464.1_g000005 Rmu_sc0000464.1_g000006 Rmu_sc0000464.1_g000007 Rmu_sc0000464.1_g000009 Rmu_sc0000464.1_g000012 Rmu_sc0000464.1_g000013 Rmu_sc0000464.1_g000015 Rmu_sc0000554.1_g000007 Rmu_sc0001469.1_g000009 Rmu_sc0002111.1_g000036 Rmu_sc0002260.1_g000046 Rmu_sc0002260.1_g000047 Rmu_sc0002260.1_g000064 Rmu_sc0002260.1_g000067 Rmu_sc0002260.1_g000068 Rmu_sc0002260.1_g000069 Rmu_sc0002260.1_g000075 Rmu_sc0002260.1_g000078 Rmu_sc0002260.1_g000079 Rmu_sc0002260.1_g000080 Rmu_sc0002260.1_g000088 Rmu_sc0002260.1_g000090 Rmu_sc0002260.1_g000093 Rmu_sc0002260.1_g000094 Rmu_sc0002260.1_g000096 Rmu_sc0004705.1_g000030 Rmu_sc0006329.1_g000002 Rmu_sc0008373.1_g000005 Rmu_sc0008373.1_g000006 Rmu_sc0008373.1_g000007 Rmu_sc0008373.1_g000009 Rmu_sc0008373.1_g000010 Rmu_sc0013971.1_g000005 Rmu_sc0028704.1_g000001 Rmu_ssc0000420.1_g000042 Rmu_ssc0000420.1_g000043
rosa_roxburghii Rroxscaffold_1G00039420 Rroxscaffold_3G00255320 Rroxscaffold_5G00354650 Rroxscaffold_5G00354670 Rroxscaffold_5G00354680 Rroxscaffold_5G00354770 Rroxscaffold_5G00354780 Rroxscaffold_5G00354840 Rroxscaffold_5G00354850 Rroxscaffold_5G00354880 Rroxscaffold_5G00355060 Rroxscaffold_5G00365850 Rroxscaffold_5G00365860 Rroxscaffold_5G00365880 Rroxscaffold_5G00365980 Rroxscaffold_5G00365990 Rroxscaffold_5G00366000 Rroxscaffold_5G00366010 Rroxscaffold_5G00366030 Rroxscaffold_5G00366040 Rroxscaffold_5G00366110 Rroxscaffold_5G00366120
rosa_rugosa Rorug04G0100900 Rorug04G0100900 Rorug04G0101000 Rorug04G0101000 Rorug04G0101100 Rorug04G0101600 Rorug04G0101700 Rorug04G0101700 Rorug04G0101900 Rorug04G0189300 Rorug04G0189400 Rorug04G0189500 Rorug04G0189500 Rorug04G0189600 Rorug04G0191600 Rorug04G0191800 Rorug04G0191800 Rorug04G0191900 Rorug04G0192000 Rorug04G0192100 Rorug04G0192200 Rorug04G0192300 Rorug04G0192500 Rorug04G0192500 Rorug04G0192600 Rorug04G0192700 Rorug04G0192700 Rorug04G0192700 Rorug04G0193200 Rorug04G0193300 Rorug04G0201800 Rorug04G0201800 Rorug07G0063300.1
rosa_samantha Rh4CG170500 Rh4CG171600 Rh4CG171900 Rh4CG262200 Rh4CG262400 Rh4CG262500 Rh4CG262600 Rh4CG262700 Rh4CG262800 Rh4CG262900 Rh4CG263000 Rh4CG264700 Rh4CG264800 Rh4CG264900 Rh4CG265000 Rh4CG265100 Rh4CG265200 Rh4CG265300 Rh4CG265500 Rh4CG265600 Rh4CG265700 Rh4CG265800 Rh4CG265900 Rh4CG266100 Rh4CG266200 Rh4CG266800 Rh4CG267200 Rh4CG275400 Rh4CG275500 Rh7CG201600
rosa_wichuraiana Rw4G013200 Rw4G013210 Rw4G013220 Rw4G013300 Rw4G021330 Rw4G021340 Rw4G021350 Rw4G021360 Rw4G021370 Rw4G021380 Rw4G021510 Rw4G021530 Rw4G021540 Rw4G021560 Rw4G021570 Rw4G021580 Rw4G021590 Rw4G021600 Rw4G021610 Rw4G021620 Rw4G021630 Rw4G021650 Rw4G021660 Rw4G022390 Rw7G016700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 147
AcoI YGGCCR 1 cut(s) 456
AcsI RAATTY 1 cut(s) 129
AfaI GTAC 1 cut(s) 59
AfiI CCNNNNNNNGG 2 cut(s) 51, 367
AflIII ACRYGT 1 cut(s) 394
AgsI TTSAA 3 cut(s) 128, 263, 433
AluBI AGCT 5 cut(s) 174, 198, 249, 255, 436
AluI AGCT 5 cut(s) 174, 198, 249, 255, 436
Ama87I CYCGRG 1 cut(s) 134
AoxI GGCC 2 cut(s) 417, 456
ApoI RAATTY 1 cut(s) 129
AspS9I GGNCC 1 cut(s) 418
AsuHPI GGTGA 1 cut(s) 191
AvaI CYCGRG 1 cut(s) 134
BalI TGGCCA 1 cut(s) 458
BccI CCATC 3 cut(s) 137, 167, 344
BfaI CTAG 1 cut(s) 51
BfmI CTRYAG 2 cut(s) 244, 250
BglII AGATCT 1 cut(s) 294
BmeT110I CYCGRG 1 cut(s) 134
BmgT120I GGNCC 1 cut(s) 418
BmiI GGNNCC 2 cut(s) 157, 334
BmsI GCATC 4 cut(s) 67, 259, 329, 457
BplI GAGNNNNNCTC 2 cut(s) 281, 313
BsaJI CCNNGG 1 cut(s) 421
Bsc4I CCNNNNNNNGG 2 cut(s) 51, 367
BseDI CCNNGG 1 cut(s) 421
BseGI GGATG 2 cut(s) 39, 274
BseLI CCNNNNNNNGG 2 cut(s) 51, 367
BseMII CTCAG 1 cut(s) 48
BshFI GGCC 2 cut(s) 419, 458
BsiHKCI CYCGRG 1 cut(s) 134
BslI CCNNNNNNNGG 2 cut(s) 51, 367
BsnI GGCC 2 cut(s) 419, 458
BsoBI CYCGRG 1 cut(s) 134
Bsp1407I TGTACA 1 cut(s) 57
Bsp143I GATC 2 cut(s) 294, 381
Bsp19I CCATGG 1 cut(s) 421
BspACI CCGC 1 cut(s) 147
BspANI GGCC 2 cut(s) 419, 458
BspCNI CTCAG 1 cut(s) 47
BspLI GGNNCC 2 cut(s) 157, 334
BsrGI TGTACA 1 cut(s) 57
BssECI CCNNGG 1 cut(s) 421
BssMI GATC 2 cut(s) 294, 381
BssT1I CCWWGG 1 cut(s) 421
Bst4CI ACNGT 1 cut(s) 124
BstAUI TGTACA 1 cut(s) 57
BstDEI CTNAG 2 cut(s) 34, 366
BstDSI CCRYGG 1 cut(s) 421
BstF5I GGATG 2 cut(s) 39, 274
BstKTI GATC 2 cut(s) 297, 384
BstMBI GATC 2 cut(s) 294, 381
BstMWI GCNNNNNNNGC 1 cut(s) 110
BstNSI RCATGY 1 cut(s) 398
BstSFI CTRYAG 2 cut(s) 244, 250
BstX2I RGATCY 1 cut(s) 294
BstYI RGATCY 1 cut(s) 294
BsuRI GGCC 2 cut(s) 419, 458
BtgI CCRYGG 1 cut(s) 421
BtsCI GGATG 2 cut(s) 39, 274
BtsI GCAGTG 1 cut(s) 334
BtsIMutI CAGTG 1 cut(s) 334
Cfr13I GGNCC 1 cut(s) 418
Csp6I GTAC 1 cut(s) 58
CviAII CATG 2 cut(s) 395, 422
CviJI RGCY 8 cut(s) 174, 198, 249, 255, 354, 419, 436, 458
CviKI_1 RGCY 8 cut(s) 174, 198, 249, 255, 354, 419, 436, 458
CviQI GTAC 1 cut(s) 58
DdeI CTNAG 2 cut(s) 34, 366
DpnI GATC 2 cut(s) 296, 383
DpnII GATC 2 cut(s) 294, 381
EaeI YGGCCR 1 cut(s) 456
Eco130I CCWWGG 1 cut(s) 421
Eco88I CYCGRG 1 cut(s) 134
EcoT14I CCWWGG 1 cut(s) 421
ErhI CCWWGG 1 cut(s) 421
FaeI CATG 2 cut(s) 398, 425
FaiI YATR 8 cut(s) 16, 30, 201, 246, 252, 303, 396, 423
FatI CATG 2 cut(s) 394, 421
FokI GGATG 2 cut(s) 26, 281
FspBI CTAG 1 cut(s) 51
HaeIII GGCC 2 cut(s) 419, 458
Hin1II CATG 2 cut(s) 398, 425
HindIII AAGCTT 1 cut(s) 434
HphI GGTGA 1 cut(s) 191
Hpy188I TCNGA 2 cut(s) 96, 280
Hpy188III TCNNGA 5 cut(s) 74, 134, 163, 343, 464
HpyAV CCTTC 2 cut(s) 176, 257
HpyCH4III ACNGT 1 cut(s) 124
HpyF10VI GCNNNNNNNGC 1 cut(s) 110
HpyF3I CTNAG 2 cut(s) 34, 366
Hsp92II CATG 2 cut(s) 398, 425
Kzo9I GATC 2 cut(s) 294, 381
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 3 cut(s) 60, 309, 364
LweI GCATC 4 cut(s) 67, 259, 329, 457
MaeI CTAG 1 cut(s) 51
MalI GATC 2 cut(s) 296, 383
MboI GATC 2 cut(s) 294, 381
MboII GAAGA 3 cut(s) 109, 304, 401
MflI RGATCY 1 cut(s) 294
MlsI TGGCCA 1 cut(s) 458
MluCI AATT 4 cut(s) 129, 222, 285, 306
MluNI TGGCCA 1 cut(s) 458
MmeI TCCRAC 2 cut(s) 133, 385
MnlI CCTC 4 cut(s) 20, 43, 130, 211
Mox20I TGGCCA 1 cut(s) 458
MscI TGGCCA 1 cut(s) 458
MseI TTAA 2 cut(s) 309, 399
Msp20I TGGCCA 1 cut(s) 458
MwoI GCNNNNNNNGC 1 cut(s) 110
NcoI CCATGG 1 cut(s) 421
NdeII GATC 2 cut(s) 294, 381
NlaIII CATG 2 cut(s) 398, 425
NlaIV GGNNCC 2 cut(s) 157, 334
NspI RCATGY 1 cut(s) 398
PaeR7I CTCGAG 1 cut(s) 134
PciI ACATGT 1 cut(s) 394
PscI ACATGT 1 cut(s) 394
PspN4I GGNNCC 2 cut(s) 157, 334
PspPI GGNCC 1 cut(s) 418
PsuI RGATCY 1 cut(s) 294
RsaI GTAC 1 cut(s) 59
RsaNI GTAC 1 cut(s) 58
SaqAI TTAA 2 cut(s) 309, 399
Sau3AI GATC 2 cut(s) 294, 381
Sau96I GGNCC 1 cut(s) 418
SetI ASST 9 cut(s) 56, 176, 200, 216, 251, 257, 405, 438, 453
SfaNI GCATC 4 cut(s) 67, 259, 329, 457
SfcI CTRYAG 2 cut(s) 244, 250
Sfr274I CTCGAG 1 cut(s) 134
SlaI CTCGAG 1 cut(s) 134
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
Sse9I AATT 4 cut(s) 129, 222, 285, 306
SsiI CCGC 1 cut(s) 147
SspMI CTAG 1 cut(s) 51
StyI CCWWGG 1 cut(s) 421
TaaI ACNGT 1 cut(s) 124
TaqI TCGA 1 cut(s) 135
TasI AATT 4 cut(s) 129, 222, 285, 306
TatI WGTACW 1 cut(s) 57
Tru1I TTAA 2 cut(s) 309, 399
Tru9I TTAA 2 cut(s) 309, 399
TscAI CASTG 1 cut(s) 334
TspDTI ATGAA 1 cut(s) 318
TspRI CASTG 1 cut(s) 334
XapI RAATTY 1 cut(s) 129
XceI RCATGY 1 cut(s) 398
XhoI CTCGAG 1 cut(s) 134
XspI CTAG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.