MD16G1161200.v1.1

Major allergen Pru

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
Physical Location & Seq
Forward (+)
13146676 .. 13147537
862 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1161200.v1.1.491

Sequence Viewer

Length: 351 bp
ATGGTCGTCCAAGTTAGAGCTAAGAAATCATCACCATGTGCGTCTTCACATACGAAACCGAATACGGCTTTGTCACCCCCTGCTAGGTTGTACAATGTCCTTGTTCTTGATACTGACAATCTCATTCCAAAGATTGCTCCACAAGCAATCAAAACTACTGAAATTCTTGAGGGAGATGGAGGTGTTGGAACCATTAAGAAGATTGGCTTTGGTGAAGGAAGTGAATACAGCTATGTGAAGCACAAGGTGGATGTGATTGACAAAGATAACTTTGTCTACAACCACAGTTTAATCGAAGAATATGCTATTTCTAAGATAATTGTAATTATTTTTAATTCTTTTTTGCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

117

Amino Acids

12.76

Weight (kDa)

7.85

Isoelectric Point (pI)

29.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Bet_v_1 PF00407 26 - 99 1e-11 Pathogenesis-related protein Bet v 1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000091)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g18830 FvH4_4g18850 FvH4_4g18851 FvH4_4g18990 FvH4_4g19000 FvH4_4g19010 FvH4_4g19020 FvH4_4g19040 FvH4_4g19050 FvH4_4g19060 FvH4_4g19080 FvH4_4g19120 FvH4_4g19170 FvH4_4g19700 FvH4_4g19710 FvH4_5g00780
malus_domestica MD13G1160600.v1.1 MD13G1160700.v1.1 MD13G1160900.v1.1 MD13G1161000.v1.1 MD13G1161100.v1.1 MD13G1161200.v1.1 MD13G1161300.v1.1 MD13G1161400.v1.1 MD16G1159900.v1.1 MD16G1160000.v1.1 MD16G1160100.v1.1 MD16G1160300.v1.1 MD16G1160400.v1.1 MD16G1160500.v1.1 MD16G1160700.v1.1 MD16G1161100.v1.1 MD16G1161200.v1.1 MD16G1161400.v1.1 MD16G1161500.v1.1
prunus_persica Prupe.1G126900_v2.0.a1 Prupe.1G126900_v2.0.a1 Prupe.1G127100_v2.0.a1 Prupe.1G127200_v2.0.a1 Prupe.1G127300_v2.0.a1 Prupe.1G127400_v2.0.a1 Prupe.1G127500_v2.0.a1 Prupe.1G127600_v2.0.a1 Prupe.1G127600_v2.0.a1 Prupe.1G127700_v2.0.a1 Prupe.1G127800_v2.0.a1 Prupe.1G127900_v2.0.a1 Prupe.1G128100_v2.0.a1 Prupe.1G128200_v2.0.a1 Prupe.1G128300_v2.0.a1 Prupe.1G128500_v2.0.a1 Prupe.1G128600_v2.0.a1 Prupe.1G128700_v2.0.a1 Prupe.6G094400_v2.0.a1
pyrus_communis pycom06g07350 pycom08g13110 pycom08g13120 pycom13g13660 pycom13g13680 pycom13g13700 pycom13g13710 pycom13g13730 pycom13g13740 pycom13g13750 pycom13g13760 pycom16g13470 pycom16g13480 pycom16g13540 pycom16g13580 pycom16g13600 pycom16g13650 pycom16g13690
rosa_chinensis RchiOBHm_Chr4g0410071 RchiOBHm_Chr4g0410081 RchiOBHm_Chr4g0410091 RchiOBHm_Chr4g0410251 RchiOBHm_Chr4g0410281 RchiOBHm_Chr4g0410291 RchiOBHm_Chr4g0423641 RchiOBHm_Chr4g0423661 RchiOBHm_Chr4g0423691 RchiOBHm_Chr4g0423701 RchiOBHm_Chr4g0423711 RchiOBHm_Chr4g0423721 RchiOBHm_Chr4g0423881 RchiOBHm_Chr4g0423891 RchiOBHm_Chr4g0423901 RchiOBHm_Chr4g0423911 RchiOBHm_Chr4g0423921 RchiOBHm_Chr4g0423931 RchiOBHm_Chr4g0423941 RchiOBHm_Chr4g0423961 RchiOBHm_Chr4g0423971 RchiOBHm_Chr4g0423991 RchiOBHm_Chr4g0424011 RchiOBHm_Chr4g0424021 RchiOBHm_Chr4g0424031 RchiOBHm_Chr4g0424041 RchiOBHm_Chr4g0424121 RchiOBHm_Chr4g0424131 RchiOBHm_Chr4g0425171 RchiOBHm_Chr4g0425181 RchiOBHm_Chr7g0201401
rosa_laevigata RLG00000003678 RLG00000007393 RLG00000007394 RLG00000007502 RLG00000007503 RLG00000007508 RLG00000007509 RLG00000007510 RLG00000007511 RLG00000007512 RLG00000007514 RLG00000007515 RLG00000007516 RLG00000007517 RLG00000007518 RLG00000007520 RLG00000007521 RLG00000007523 RLG00000007535 RLG00000007536 RLG00000007537 RLG00000007538 RLG00000007539 RLG00000008440 RLG00000008441 RLG00000008491 RLG00000008504
rosa_multiflora Rmu_co8215346.1_g000001 Rmu_sc0000365.1_g000047 Rmu_sc0000365.1_g000054 Rmu_sc0000365.1_g000055 Rmu_sc0000464.1_g000004 Rmu_sc0000464.1_g000005 Rmu_sc0000464.1_g000006 Rmu_sc0000464.1_g000007 Rmu_sc0000464.1_g000009 Rmu_sc0000464.1_g000012 Rmu_sc0000464.1_g000013 Rmu_sc0000464.1_g000015 Rmu_sc0000554.1_g000007 Rmu_sc0001469.1_g000009 Rmu_sc0002111.1_g000036 Rmu_sc0002260.1_g000046 Rmu_sc0002260.1_g000047 Rmu_sc0002260.1_g000064 Rmu_sc0002260.1_g000067 Rmu_sc0002260.1_g000068 Rmu_sc0002260.1_g000069 Rmu_sc0002260.1_g000075 Rmu_sc0002260.1_g000078 Rmu_sc0002260.1_g000079 Rmu_sc0002260.1_g000080 Rmu_sc0002260.1_g000088 Rmu_sc0002260.1_g000090 Rmu_sc0002260.1_g000093 Rmu_sc0002260.1_g000094 Rmu_sc0002260.1_g000096 Rmu_sc0004705.1_g000030 Rmu_sc0006329.1_g000002 Rmu_sc0008373.1_g000005 Rmu_sc0008373.1_g000006 Rmu_sc0008373.1_g000007 Rmu_sc0008373.1_g000009 Rmu_sc0008373.1_g000010 Rmu_sc0013971.1_g000005 Rmu_sc0028704.1_g000001 Rmu_ssc0000420.1_g000042 Rmu_ssc0000420.1_g000043
rosa_roxburghii Rroxscaffold_1G00039420 Rroxscaffold_3G00255320 Rroxscaffold_5G00354650 Rroxscaffold_5G00354670 Rroxscaffold_5G00354680 Rroxscaffold_5G00354770 Rroxscaffold_5G00354780 Rroxscaffold_5G00354840 Rroxscaffold_5G00354850 Rroxscaffold_5G00354880 Rroxscaffold_5G00355060 Rroxscaffold_5G00365850 Rroxscaffold_5G00365860 Rroxscaffold_5G00365880 Rroxscaffold_5G00365980 Rroxscaffold_5G00365990 Rroxscaffold_5G00366000 Rroxscaffold_5G00366010 Rroxscaffold_5G00366030 Rroxscaffold_5G00366040 Rroxscaffold_5G00366110 Rroxscaffold_5G00366120
rosa_rugosa Rorug04G0100900 Rorug04G0100900 Rorug04G0101000 Rorug04G0101000 Rorug04G0101100 Rorug04G0101600 Rorug04G0101700 Rorug04G0101700 Rorug04G0101900 Rorug04G0189300 Rorug04G0189400 Rorug04G0189500 Rorug04G0189500 Rorug04G0189600 Rorug04G0191600 Rorug04G0191800 Rorug04G0191800 Rorug04G0191900 Rorug04G0192000 Rorug04G0192100 Rorug04G0192200 Rorug04G0192300 Rorug04G0192500 Rorug04G0192500 Rorug04G0192600 Rorug04G0192700 Rorug04G0192700 Rorug04G0192700 Rorug04G0193200 Rorug04G0193300 Rorug04G0201800 Rorug04G0201800 Rorug07G0063300.1
rosa_samantha Rh4CG170500 Rh4CG171600 Rh4CG171900 Rh4CG262200 Rh4CG262400 Rh4CG262500 Rh4CG262600 Rh4CG262700 Rh4CG262800 Rh4CG262900 Rh4CG263000 Rh4CG264700 Rh4CG264800 Rh4CG264900 Rh4CG265000 Rh4CG265100 Rh4CG265200 Rh4CG265300 Rh4CG265500 Rh4CG265600 Rh4CG265700 Rh4CG265800 Rh4CG265900 Rh4CG266100 Rh4CG266200 Rh4CG266800 Rh4CG267200 Rh4CG275400 Rh4CG275500 Rh7CG201600
rosa_wichuraiana Rw4G013200 Rw4G013210 Rw4G013220 Rw4G013300 Rw4G021330 Rw4G021340 Rw4G021350 Rw4G021360 Rw4G021370 Rw4G021380 Rw4G021510 Rw4G021530 Rw4G021540 Rw4G021560 Rw4G021570 Rw4G021580 Rw4G021590 Rw4G021600 Rw4G021610 Rw4G021620 Rw4G021630 Rw4G021650 Rw4G021660 Rw4G022390 Rw7G016700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 276
AcsI RAATTY 1 cut(s) 162
AdeI CACNNNGTG 2 cut(s) 38, 247
AfaI GTAC 1 cut(s) 92
AfiI CCNNNNNNNGG 1 cut(s) 84
AluBI AGCT 2 cut(s) 20, 231
AluI AGCT 2 cut(s) 20, 231
ApoI RAATTY 1 cut(s) 162
AsuHPI GGTGA 3 cut(s) 24, 66, 224
BbsI GAAGAC 1 cut(s) 36
BccI CCATC 1 cut(s) 170
BceAI ACGGC 1 cut(s) 81
BcgI CGANNNNNNTGC 2 cut(s) 284, 318
BfaI CTAG 1 cut(s) 84
BmiI GGNNCC 1 cut(s) 190
BpiI GAAGAC 1 cut(s) 36
BpuEI CTTGAG 1 cut(s) 188
Bsc4I CCNNNNNNNGG 1 cut(s) 84
BseGI GGATG 1 cut(s) 256
BseLI CCNNNNNNNGG 1 cut(s) 84
BslI CCNNNNNNNGG 1 cut(s) 84
Bsp1407I TGTACA 1 cut(s) 90
BspLI GGNNCC 1 cut(s) 190
BsrGI TGTACA 1 cut(s) 90
Bst4CI ACNGT 1 cut(s) 287
BstAUI TGTACA 1 cut(s) 90
BstDEI CTNAG 2 cut(s) 21, 312
BstF5I GGATG 1 cut(s) 256
BstMWI GCNNNNNNNGC 1 cut(s) 143
BstV2I GAAGAC 1 cut(s) 36
BtsCI GGATG 1 cut(s) 256
CseI GACGC 1 cut(s) 30
Csp6I GTAC 1 cut(s) 91
CviAII CATG 1 cut(s) 36
CviJI RGCY 4 cut(s) 20, 68, 207, 231
CviKI_1 RGCY 4 cut(s) 20, 68, 207, 231
CviQI GTAC 1 cut(s) 91
DdeI CTNAG 2 cut(s) 21, 312
DraIII CACNNNGTG 2 cut(s) 38, 247
FaeI CATG 1 cut(s) 39
FaiI YATR 4 cut(s) 37, 51, 234, 303
FalI AAGNNNNNCTT 2 cut(s) 191, 223
FatI CATG 1 cut(s) 35
FblI GTMKAC 1 cut(s) 276
FokI GGATG 1 cut(s) 263
FspBI CTAG 1 cut(s) 84
HgaI GACGC 1 cut(s) 30
Hin1II CATG 1 cut(s) 39
HphI GGTGA 3 cut(s) 24, 66, 224
Hpy166II GTNNAC 1 cut(s) 277
Hpy188III TCNNGA 2 cut(s) 107, 167
Hpy8I GTNNAC 1 cut(s) 277
HpyAV CCTTC 1 cut(s) 209
HpyCH4III ACNGT 1 cut(s) 287
HpyCH4V TGCA 1 cut(s) 346
HpyF10VI GCNNNNNNNGC 1 cut(s) 143
HpyF3I CTNAG 2 cut(s) 21, 312
Hsp92II CATG 1 cut(s) 39
LmnI GCTCC 1 cut(s) 142
LpnPI CCDG 1 cut(s) 93
MaeI CTAG 1 cut(s) 84
MaeIII GTNAC 1 cut(s) 72
MboII GAAGA 3 cut(s) 36, 211, 308
MluCI AATT 4 cut(s) 162, 318, 324, 334
MmeI TCCRAC 1 cut(s) 166
MnlI CCTC 2 cut(s) 163, 173
MseI TTAA 4 cut(s) 195, 290, 333, 349
MslI CAYNNNNRTG 1 cut(s) 34
MwoI GCNNNNNNNGC 1 cut(s) 143
NlaIII CATG 1 cut(s) 39
NlaIV GGNNCC 1 cut(s) 190
NmuCI GTSAC 1 cut(s) 72
PspN4I GGNNCC 1 cut(s) 190
RsaI GTAC 1 cut(s) 92
RsaNI GTAC 1 cut(s) 91
RseI CAYNNNNRTG 1 cut(s) 34
SaqAI TTAA 4 cut(s) 195, 290, 333, 349
SetI ASST 5 cut(s) 22, 89, 184, 233, 249
SgeI CNNG 9 cut(s) 23, 48, 92, 96, 113, 119, 155, 179, 256
SmiMI CAYNNNNRTG 1 cut(s) 34
SmlI CTYRAG 1 cut(s) 167
SmoI CTYRAG 1 cut(s) 167
Sse9I AATT 4 cut(s) 162, 318, 324, 334
SspMI CTAG 1 cut(s) 84
TaaI ACNGT 1 cut(s) 287
TaqI TCGA 1 cut(s) 294
TasI AATT 4 cut(s) 162, 318, 324, 334
TatI WGTACW 1 cut(s) 90
Tru1I TTAA 4 cut(s) 195, 290, 333, 349
Tru9I TTAA 4 cut(s) 195, 290, 333, 349
TseFI GTSAC 1 cut(s) 72
Tsp45I GTSAC 1 cut(s) 72
XapI RAATTY 1 cut(s) 162
XmiI GTMKAC 1 cut(s) 276
XspI CTAG 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.