Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp01

Orthogroup ID

OG0002468

Physical Location & Seq

Genomic Coordinates Reverse (-)

7677848 .. 7678252

Gene Structure 405 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.1G096600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 405 bp

ATGCCTTGGGTGTTGAGGAGGCATTACACTAGTGATGGGAGGCTGATTCTCAATGAGGAGAAGGTTAGGCATCATAAGTACTTTAGGGCTCATAGGTCCAATGGAAGGCTTACTTTGCAGCTTGTGCCACTTGATGATGAGATTTTGATTCCACCATTTGTTTGTGATGAGGGTAACAAAGATGAGAATGGGAATGGAAATGGAATTGAGAATGAGTGTGATGATCATGACCAAAATTTTGATGACCATGATGACGACGATGACGACGATCATGTGGTTGAGGATCAAGCAATTAGTGGTATTGGGGGATCACCAGGGAAATGCTTCAATTTCAATAGTTTGTTAAGAGGGCCACCTTGCATCTTTGGAGTGCCAGTGCCAGCCATCAGGCATGTTCACAGCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FAF

Protein Analysis

135

Amino Acids

15.17

Weight (kDa)

4.87

Isoelectric Point (pI)

56.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002468)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G22110 AT1G22110 AT1G22110 AT1G77932
fragaria_vesca	FvH4_5g38140 FvH4_5g38160 FvH4_5g38160 FvH4_5g38160
malus_domestica	MD08G1176500.v1.1 MD08G1219800.v1.1 MD15G1363200.v1.1 MD15G1408400.v1.1 MD15G1409900.v1.1
prunus_persica	Prupe.1G096600_v2.0.a1 Prupe.1G510300_v2.0.a1 Prupe.1G510900_v2.0.a1 Prupe.1G552400_v2.0.a1
pyrus_communis	pycom08g19080 pycom15g32490
rosa_chinensis	RchiOBHm_Chr7g0240121
rosa_laevigata	RLG00000000700 RLG00000000701
rosa_multiflora	Rmu_sc0005008.1_g000021 Rmu_sc0005008.1_g000024
rosa_roxburghii	Rroxscaffold_3G00220390 Rroxscaffold_3G00220400
rosa_rugosa	Rorug04G0113200 Rorug07G0333300 Rorug07G0333500 Rorug07G0333600 Rorug07G0333700 Rorug07G0333800
rosa_samantha	Rh7AG487000 Rh7AG487200 Rh7BG459700 Rh7CG503800 Rh7CG503900 Rh7DG472100 Rh7DG472200
rosa_wichuraiana	Rw7G040810 Rw7G040820

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	291, 316
AcsI	RAATTY	1 cut(s)	235
AfaI	GTAC	1 cut(s)	80
AfiI	CCNNNNNNNGG	1 cut(s)	105
AgsI	TTSAA	2 cut(s)	328, 334
AhlI	ACTAGT	1 cut(s)	29
AjnI	CCWGG	1 cut(s)	313
AluBI	AGCT	2 cut(s)	121, 402
AluI	AGCT	2 cut(s)	121, 402
AlwI	GGATC	2 cut(s)	291, 316
AoxI	GGCC	1 cut(s)	350
ApeKI	GCWGC	1 cut(s)	118
ApoI	RAATTY	1 cut(s)	235
ArsI	GACNNNNNNTTYG	2 cut(s)	221, 253
Asp700I	GAANNNNTTC	1 cut(s)	323
AspS9I	GGNCC	2 cut(s)	96, 350
AsuHPI	GGTGA	1 cut(s)	303
AvaII	GGWCC	1 cut(s)	96
BanII	GRGCYC	1 cut(s)	91
BbvI	GCAGC	1 cut(s)	130
BccI	CCATC	2 cut(s)	29, 392
BciT130I	CCWGG	1 cut(s)	315
BclI	TGATCA	1 cut(s)	223
BcuI	ACTAGT	1 cut(s)	29
BfaI	CTAG	1 cut(s)	30
BisI	GCNGC	1 cut(s)	119
BlsI	GCNGC	1 cut(s)	120
BmcAI	AGTACT	1 cut(s)	80
Bme1390I	CCNGG	1 cut(s)	315
Bme18I	GGWCC	1 cut(s)	96
BmgT120I	GGNCC	2 cut(s)	96, 350
BmrFI	CCNGG	1 cut(s)	315
BmsI	GCATC	2 cut(s)	79, 369
BsaJI	CCNNGG	2 cut(s)	5, 314
BsaXI	ACNNNNNCTCC	2 cut(s)	360, 390
Bsc4I	CCNNNNNNNGG	1 cut(s)	105
Bse1I	ACTGG	1 cut(s)	374
BseBI	CCWGG	1 cut(s)	315
BseDI	CCNNGG	2 cut(s)	5, 314
BseLI	CCNNNNNNNGG	1 cut(s)	105
BseNI	ACTGG	1 cut(s)	374
BseRI	GAGGAG	2 cut(s)	31, 71
BseXI	GCAGC	1 cut(s)	130
BshFI	GGCC	1 cut(s)	352
BslI	CCNNNNNNNGG	1 cut(s)	105
BsnI	GGCC	1 cut(s)	352
Bsp1286I	GDGCHC	1 cut(s)	91
Bsp143I	GATC	4 cut(s)	223, 268, 283, 308
BspANI	GGCC	1 cut(s)	352
BspHI	TCATGA	1 cut(s)	226
BspPI	GGATC	2 cut(s)	291, 316
BsrI	ACTGG	1 cut(s)	374
BssECI	CCNNGG	2 cut(s)	5, 314
BssMI	GATC	4 cut(s)	223, 268, 283, 308
BssT1I	CCWWGG	1 cut(s)	5
Bst2UI	CCWGG	1 cut(s)	315
BstAPI	GCANNNNNTGC	1 cut(s)	124
BstC8I	GCNNGC	1 cut(s)	381
BstKTI	GATC	4 cut(s)	226, 271, 286, 311
BstMBI	GATC	4 cut(s)	223, 268, 283, 308
BstMWI	GCNNNNNNNGC	2 cut(s)	115, 124
BstNI	CCWGG	1 cut(s)	315
BstNSI	RCATGY	1 cut(s)	395
BstSCI	CCNGG	1 cut(s)	313
BstV1I	GCAGC	1 cut(s)	130
BsuRI	GGCC	1 cut(s)	352
BtsIMutI	CAGTG	1 cut(s)	381
Cac8I	GCNNGC	1 cut(s)	381
CciI	TCATGA	1 cut(s)	226
Cfr13I	GGNCC	2 cut(s)	96, 350
Csp6I	GTAC	1 cut(s)	79
CviAII	CATG	4 cut(s)	227, 248, 272, 392
CviJI	RGCY	7 cut(s)	43, 89, 109, 121, 352, 383, 402
CviKI_1	RGCY	7 cut(s)	43, 89, 109, 121, 352, 383, 402
CviQI	GTAC	1 cut(s)	79
DpnI	GATC	4 cut(s)	225, 270, 285, 310
DpnII	GATC	4 cut(s)	223, 268, 283, 308
Eco130I	CCWWGG	1 cut(s)	5
Eco24I	GRGCYC	1 cut(s)	91
Eco47I	GGWCC	1 cut(s)	96
EcoRII	CCWGG	1 cut(s)	313
EcoT14I	CCWWGG	1 cut(s)	5
EcoT38I	GRGCYC	1 cut(s)	91
ErhI	CCWWGG	1 cut(s)	5
FaeI	CATG	4 cut(s)	230, 251, 275, 395
FaiI	YATR	6 cut(s)	75, 93, 228, 249, 273, 393
FalI	AAGNNNNNCTT	2 cut(s)	97, 129
FatI	CATG	4 cut(s)	226, 247, 271, 391
FbaI	TGATCA	1 cut(s)	223
Fnu4HI	GCNGC	1 cut(s)	119
FriOI	GRGCYC	1 cut(s)	91
Fsp4HI	GCNGC	1 cut(s)	119
FspBI	CTAG	1 cut(s)	30
GluI	GCNGC	1 cut(s)	119
HaeIII	GGCC	1 cut(s)	352
Hin1II	CATG	4 cut(s)	230, 251, 275, 395
HinfI	GANTC	2 cut(s)	46, 148
HphI	GGTGA	1 cut(s)	303
Hpy166II	GTNNAC	1 cut(s)	397
Hpy188III	TCNNGA	1 cut(s)	227
Hpy8I	GTNNAC	1 cut(s)	397
Hpy99I	CGWCG	2 cut(s)	260, 269
HpyAV	CCTTC	2 cut(s)	55, 99
HpyCH4V	TGCA	2 cut(s)	118, 360
HpyF10VI	GCNNNNNNNGC	2 cut(s)	115, 124
Hsp92II	CATG	4 cut(s)	230, 251, 275, 395
Ksp22I	TGATCA	1 cut(s)	223
Kzo9I	GATC	4 cut(s)	223, 268, 283, 308
LpnPI	CCDG	5 cut(s)	300, 327, 373, 387, 393
Lsp1109I	GCAGC	1 cut(s)	130
LweI	GCATC	2 cut(s)	79, 369
MaeI	CTAG	1 cut(s)	30
MaeIII	GTNAC	1 cut(s)	173
MalI	GATC	4 cut(s)	225, 270, 285, 310
MboI	GATC	4 cut(s)	223, 268, 283, 308
MhlI	GDGCHC	1 cut(s)	91
MluCI	AATT	4 cut(s)	204, 235, 291, 328
MnlI	CCTC	7 cut(s)	9, 12, 33, 49, 163, 274, 341
MroXI	GAANNNNTTC	1 cut(s)	323
MseI	TTAA	1 cut(s)	344
MspR9I	CCNGG	1 cut(s)	315
MvaI	CCWGG	1 cut(s)	315
MwoI	GCNNNNNNNGC	2 cut(s)	115, 124
NdeII	GATC	4 cut(s)	223, 268, 283, 308
NlaIII	CATG	4 cut(s)	230, 251, 275, 395
NspI	RCATGY	1 cut(s)	395
PagI	TCATGA	1 cut(s)	226
PcsI	WCGNNNNNNNCGW	2 cut(s)	261, 264
PdmI	GAANNNNTTC	1 cut(s)	323
PfeI	GAWTC	2 cut(s)	46, 148
PkrI	GCNGC	1 cut(s)	120
Psp6I	CCWGG	1 cut(s)	313
PspGI	CCWGG	1 cut(s)	313
PspPI	GGNCC	2 cut(s)	96, 350
RsaI	GTAC	1 cut(s)	80
RsaNI	GTAC	1 cut(s)	79
SaqAI	TTAA	1 cut(s)	344
SatI	GCNGC	1 cut(s)	119
Sau3AI	GATC	4 cut(s)	223, 268, 283, 308
Sau96I	GGNCC	2 cut(s)	96, 350
ScaI	AGTACT	1 cut(s)	80
ScrFI	CCNGG	1 cut(s)	315
SduI	GDGCHC	1 cut(s)	91
SetI	ASST	5 cut(s)	66, 98, 123, 358, 404
SfaNI	GCATC	2 cut(s)	79, 369
SinI	GGWCC	1 cut(s)	96
SpeI	ACTAGT	1 cut(s)	29
Sse9I	AATT	4 cut(s)	204, 235, 291, 328
SspMI	CTAG	1 cut(s)	30
StyD4I	CCNGG	1 cut(s)	313
StyI	CCWWGG	1 cut(s)	5
TasI	AATT	4 cut(s)	204, 235, 291, 328
TatI	WGTACW	1 cut(s)	78
TfiI	GAWTC	2 cut(s)	46, 148
Tru1I	TTAA	1 cut(s)	344
Tru9I	TTAA	1 cut(s)	344
TscAI	CASTG	1 cut(s)	381
TseI	GCWGC	1 cut(s)	118
TspRI	CASTG	1 cut(s)	381
VpaK11BI	GGWCC	1 cut(s)	96
XapI	RAATTY	1 cut(s)	235
XceI	RCATGY	1 cut(s)	395
XmnI	GAANNNNTTC	1 cut(s)	323
XspI	CTAG	1 cut(s)	30
ZrmI	AGTACT	1 cut(s)	80

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.