Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000007

Orthogroup ID

OG0002468

Physical Location & Seq

Genomic Coordinates Reverse (-)

36555953 .. 36556540

Gene Structure 588 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug07G0333500.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 588 bp

ATGAAGTGGAAAGTTAATGTTGGACCAAGGATCCAAACACTAATTGTAAAGACGGCTAGAGAATACTATGGATATAGATCAACGGATTATACCTTCAAAATTGTTGGTAGAAGTGGTAGTGTTCTTTCATCAAAACATACCATTGATTTGGCTAAGAGGATTTGCGCATGTAGAGGGTGGATGATGTCTGGAATTCCTTGTCCTCATGCCATTTGTTGCATCTTTCTTAAAGGACATGAACCCATTGACTATGTGGATGACTGTTATAGTAAGGAAGTCTACCTCAATGCATATGCACATCCTATAAATCATGTTCCTGGAGTTGAACTATTGCCTGAGATTCGTGCTCCTATTCATCCTCCACCATTTACGAGGCAAGCTGGAAGACCAAAAATGCCTAGAAGGAGGGAGAAAGATGAGCAACCACCAGCTCCTAATGTTGGGGCTACTGAGGCTGGCATAACTAAGATGGCCAGGAGATCATACGTGACTACGTCATGCACAACATGTGGTTCAGAGGACCATAACAAGAGGACTTGCCTTATTGAGCGTGTCAAGAAGGCAATGAATGCATCTGAGATTATTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FAF

Protein Analysis

195

Amino Acids

21.98

Weight (kDa)

9.39

Isoelectric Point (pI)

63.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002468)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G22110 AT1G22110 AT1G22110 AT1G77932
fragaria_vesca	FvH4_5g38140 FvH4_5g38160 FvH4_5g38160 FvH4_5g38160
malus_domestica	MD08G1176500.v1.1 MD08G1219800.v1.1 MD15G1363200.v1.1 MD15G1408400.v1.1 MD15G1409900.v1.1
prunus_persica	Prupe.1G096600_v2.0.a1 Prupe.1G510300_v2.0.a1 Prupe.1G510900_v2.0.a1 Prupe.1G552400_v2.0.a1
pyrus_communis	pycom08g19080 pycom15g32490
rosa_chinensis	RchiOBHm_Chr7g0240121
rosa_laevigata	RLG00000000700 RLG00000000701
rosa_multiflora	Rmu_sc0005008.1_g000021 Rmu_sc0005008.1_g000024
rosa_roxburghii	Rroxscaffold_3G00220390 Rroxscaffold_3G00220400
rosa_rugosa	Rorug04G0113200 Rorug07G0333300 Rorug07G0333500 Rorug07G0333600 Rorug07G0333700 Rorug07G0333800
rosa_samantha	Rh7AG487000 Rh7AG487200 Rh7BG459700 Rh7CG503800 Rh7CG503900 Rh7DG472100 Rh7DG472200
rosa_wichuraiana	Rw7G040810 Rw7G040820

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	166
AccI	GTMKAC	1 cut(s)	279
AclWI	GGATC	2 cut(s)	25, 38
AcoI	YGGCCR	1 cut(s)	471
AcsI	RAATTY	1 cut(s)	192
AfiI	CCNNNNNNNGG	1 cut(s)	440
AflIII	ACRYGT	1 cut(s)	506
AgsI	TTSAA	2 cut(s)	97, 326
AjnI	CCWGG	2 cut(s)	316, 473
AluBI	AGCT	2 cut(s)	380, 431
AluI	AGCT	2 cut(s)	380, 431
Alw21I	GWGCWC	1 cut(s)	349
AlwI	GGATC	2 cut(s)	25, 38
AoxI	GGCC	1 cut(s)	471
ApoI	RAATTY	1 cut(s)	192
AspLEI	GCGC	1 cut(s)	167
AspS9I	GGNCC	2 cut(s)	23, 520
AvaII	GGWCC	2 cut(s)	23, 520
BalI	TGGCCA	1 cut(s)	473
BamHI	GGATCC	1 cut(s)	30
BbsI	GAAGAC	1 cut(s)	391
Bbv12I	GWGCWC	1 cut(s)	349
BccI	CCATC	1 cut(s)	463
BceAI	ACGGC	1 cut(s)	69
BciT130I	CCWGG	2 cut(s)	318, 475
BfaI	CTAG	2 cut(s)	57, 399
Bme1390I	CCNGG	2 cut(s)	318, 475
Bme18I	GGWCC	2 cut(s)	23, 520
BmgT120I	GGNCC	2 cut(s)	23, 520
BmiI	GGNNCC	1 cut(s)	32
BmrFI	CCNGG	2 cut(s)	318, 475
BmsI	GCATC	2 cut(s)	228, 581
BpiI	GAAGAC	1 cut(s)	391
BpmI	CTGGAG	1 cut(s)	339
BsaAI	YACGTR	1 cut(s)	487
BsaBI	GATNNNNATC	1 cut(s)	76
BsaJI	CCNNGG	1 cut(s)	26
Bsc4I	CCNNNNNNNGG	1 cut(s)	440
Bse3DI	GCAATG	1 cut(s)	570
Bse8I	GATNNNNATC	1 cut(s)	76
BseBI	CCWGG	2 cut(s)	318, 475
BseDI	CCNNGG	1 cut(s)	26
BseGI	GGATG	4 cut(s)	186, 262, 298, 355
BseJI	GATNNNNATC	1 cut(s)	76
BseLI	CCNNNNNNNGG	1 cut(s)	440
BseMI	GCAATG	1 cut(s)	570
BseMII	CTCAG	3 cut(s)	327, 441, 567
BshFI	GGCC	1 cut(s)	473
BsiHKAI	GWGCWC	1 cut(s)	349
BslI	CCNNNNNNNGG	1 cut(s)	440
BsmI	GAATGC	1 cut(s)	574
BsnI	GGCC	1 cut(s)	473
Bsp1286I	GDGCHC	1 cut(s)	349
Bsp143I	GATC	3 cut(s)	30, 77, 479
BspANI	GGCC	1 cut(s)	473
BspCNI	CTCAG	3 cut(s)	328, 442, 568
BspLI	GGNNCC	1 cut(s)	32
BspPI	GGATC	2 cut(s)	25, 38
BsrDI	GCAATG	1 cut(s)	570
BssECI	CCNNGG	1 cut(s)	26
BssMI	GATC	3 cut(s)	30, 77, 479
BssT1I	CCWWGG	1 cut(s)	26
Bst2UI	CCWGG	2 cut(s)	318, 475
Bst4CI	ACNGT	1 cut(s)	263
BstAPI	GCANNNNNTGC	1 cut(s)	569
BstBAI	YACGTR	1 cut(s)	487
BstC8I	GCNNGC	2 cut(s)	378, 457
BstDEI	CTNAG	5 cut(s)	153, 336, 450, 465, 576
BstF5I	GGATG	4 cut(s)	186, 262, 298, 355
BstHHI	GCGC	1 cut(s)	167
BstKTI	GATC	3 cut(s)	33, 80, 482
BstMBI	GATC	3 cut(s)	30, 77, 479
BstMWI	GCNNNNNNNGC	2 cut(s)	452, 569
BstNI	CCWGG	2 cut(s)	318, 475
BstNSI	RCATGY	2 cut(s)	171, 510
BstSCI	CCNGG	2 cut(s)	316, 473
BstV2I	GAAGAC	1 cut(s)	391
BstX2I	RGATCY	1 cut(s)	30
BstXI	CCANNNNNNTGG	1 cut(s)	148
BstYI	RGATCY	1 cut(s)	30
BsuRI	GGCC	1 cut(s)	473
BtsCI	GGATG	4 cut(s)	186, 262, 298, 355
Cac8I	GCNNGC	2 cut(s)	378, 457
CfoI	GCGC	1 cut(s)	167
Cfr13I	GGNCC	2 cut(s)	23, 520
CviAII	CATG	6 cut(s)	168, 206, 236, 311, 498, 507
CviJI	RGCY	7 cut(s)	56, 152, 380, 431, 446, 455, 473
CviKI_1	RGCY	7 cut(s)	56, 152, 380, 431, 446, 455, 473
DdeI	CTNAG	5 cut(s)	153, 336, 450, 465, 576
DpnI	GATC	3 cut(s)	32, 79, 481
DpnII	GATC	3 cut(s)	30, 77, 479
EaeI	YGGCCR	1 cut(s)	471
Eco130I	CCWWGG	1 cut(s)	26
Eco47I	GGWCC	2 cut(s)	23, 520
EcoRI	GAATTC	1 cut(s)	192
EcoRII	CCWGG	2 cut(s)	316, 473
EcoT14I	CCWWGG	1 cut(s)	26
EcoT22I	ATGCAT	2 cut(s)	292, 574
ErhI	CCWWGG	1 cut(s)	26
FaeI	CATG	6 cut(s)	171, 209, 239, 314, 501, 510
FatI	CATG	6 cut(s)	167, 205, 235, 310, 497, 506
FauNDI	CATATG	1 cut(s)	292
FblI	GTMKAC	1 cut(s)	279
FokI	GGATG	4 cut(s)	193, 269, 285, 342
FspBI	CTAG	2 cut(s)	57, 399
FspI	TGCGCA	1 cut(s)	166
GlaI	GCGC	1 cut(s)	166
GsuI	CTGGAG	1 cut(s)	339
HaeIII	GGCC	1 cut(s)	473
HhaI	GCGC	1 cut(s)	167
Hin1II	CATG	6 cut(s)	171, 209, 239, 314, 501, 510
Hin6I	GCGC	1 cut(s)	165
HinP1I	GCGC	1 cut(s)	165
HinfI	GANTC	1 cut(s)	340
Hpy166II	GTNNAC	1 cut(s)	280
Hpy188I	TCNGA	2 cut(s)	517, 577
Hpy188III	TCNNGA	2 cut(s)	189, 556
Hpy8I	GTNNAC	1 cut(s)	280
HpyAV	CCTTC	3 cut(s)	103, 396, 553
HpyCH4III	ACNGT	1 cut(s)	263
HpyCH4IV	ACGT	2 cut(s)	486, 494
HpyCH4V	TGCA	5 cut(s)	219, 290, 296, 501, 572
HpyF10VI	GCNNNNNNNGC	2 cut(s)	452, 569
HpyF3I	CTNAG	5 cut(s)	153, 336, 450, 465, 576
HpySE526I	ACGT	2 cut(s)	486, 494
Hsp92II	CATG	6 cut(s)	171, 209, 239, 314, 501, 510
HspAI	GCGC	1 cut(s)	165
Kzo9I	GATC	3 cut(s)	30, 77, 479
LmnI	GCTCC	2 cut(s)	352, 436
LpnPI	CCDG	9 cut(s)	174, 303, 330, 348, 366, 441, 441, 460, 487
LweI	GCATC	2 cut(s)	228, 581
MaeI	CTAG	2 cut(s)	57, 399
MaeII	ACGT	2 cut(s)	486, 494
MaeIII	GTNAC	1 cut(s)	487
MalI	GATC	3 cut(s)	32, 79, 481
MboI	GATC	3 cut(s)	30, 77, 479
MboII	GAAGA	1 cut(s)	396
MflI	RGATCY	1 cut(s)	30
MhlI	GDGCHC	1 cut(s)	349
MlsI	TGGCCA	1 cut(s)	473
MluCI	AATT	3 cut(s)	42, 99, 192
MluNI	TGGCCA	1 cut(s)	473
Mox20I	TGGCCA	1 cut(s)	473
Mph1103I	ATGCAT	2 cut(s)	292, 574
MscI	TGGCCA	1 cut(s)	473
MseI	TTAA	3 cut(s)	15, 228, 586
Msp20I	TGGCCA	1 cut(s)	473
MspR9I	CCNGG	2 cut(s)	318, 475
Mva1269I	GAATGC	1 cut(s)	574
MvaI	CCWGG	2 cut(s)	318, 475
MwoI	GCNNNNNNNGC	2 cut(s)	452, 569
NdeI	CATATG	1 cut(s)	292
NdeII	GATC	3 cut(s)	30, 77, 479
NlaIII	CATG	6 cut(s)	171, 209, 239, 314, 501, 510
NlaIV	GGNNCC	1 cut(s)	32
NmuCI	GTSAC	1 cut(s)	487
NsbI	TGCGCA	1 cut(s)	166
NsiI	ATGCAT	2 cut(s)	292, 574
NspI	RCATGY	2 cut(s)	171, 510
PciI	ACATGT	1 cut(s)	506
PctI	GAATGC	1 cut(s)	574
PfeI	GAWTC	1 cut(s)	340
PflFI	GACNNNGTC	1 cut(s)	493
PfoI	TCCNGGA	1 cut(s)	316
Ppu21I	YACGTR	1 cut(s)	487
PscI	ACATGT	1 cut(s)	506
Psp6I	CCWGG	2 cut(s)	316, 473
PspGI	CCWGG	2 cut(s)	316, 473
PspN4I	GGNNCC	1 cut(s)	32
PspPI	GGNCC	2 cut(s)	23, 520
PsuI	RGATCY	1 cut(s)	30
PsyI	GACNNNGTC	1 cut(s)	493
SaqAI	TTAA	3 cut(s)	15, 228, 586
Sau3AI	GATC	3 cut(s)	30, 77, 479
Sau96I	GGNCC	2 cut(s)	23, 520
ScrFI	CCNGG	2 cut(s)	318, 475
SduI	GDGCHC	1 cut(s)	349
SetI	ASST	6 cut(s)	95, 285, 382, 433, 489, 497
SfaNI	GCATC	2 cut(s)	228, 581
SinI	GGWCC	2 cut(s)	23, 520
Sse9I	AATT	3 cut(s)	42, 99, 192
SspMI	CTAG	2 cut(s)	57, 399
StyD4I	CCNGG	2 cut(s)	316, 473
StyI	CCWWGG	1 cut(s)	26
TaaI	ACNGT	1 cut(s)	263
TaiI	ACGT	2 cut(s)	489, 497
TasI	AATT	3 cut(s)	42, 99, 192
TfiI	GAWTC	1 cut(s)	340
Tru1I	TTAA	3 cut(s)	15, 228, 586
Tru9I	TTAA	3 cut(s)	15, 228, 586
TseFI	GTSAC	1 cut(s)	487
Tsp45I	GTSAC	1 cut(s)	487
TspDTI	ATGAA	5 cut(s)	17, 117, 252, 344, 581
TspGWI	ACGGA	1 cut(s)	98
Tth111I	GACNNNGTC	1 cut(s)	493
VpaK11BI	GGWCC	2 cut(s)	23, 520
XapI	RAATTY	1 cut(s)	192
XceI	RCATGY	2 cut(s)	171, 510
XcmI	CCANNNNNNNNNTGG	1 cut(s)	250
XmiI	GTMKAC	1 cut(s)	279
XspI	CTAG	2 cut(s)	57, 399
Zsp2I	ATGCAT	2 cut(s)	292, 574

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.