RchiOBHm_Chr1g0321231

Ribosome production factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0002361
Physical Location & Seq
Forward (+)
8811265 .. 8813111
1847 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 579 bp
ATGTATTGGGGTCCTGCTTTTATAGAGGAACTACTTTCGGTGATCCCAAATGCGCAGTACTATAAAAGAGGCACTTATGACTTGAAAAAGATTATAGAGTATGCAAATAAAAAGGAATTCACTTCTTTAATTGTTGTTCATACCAATCGCTGGGAACCAGATGCTCTCCTAATTATTGGCTTACCTAATGGACATACTACCCATTTTAAGCTCTCAAAGCTTGTTTTACGGAAGGATATCAAGAATCATGGAAATCCAACCAGTCATGAGCCTGAGCTTGTATTAAACAACTTTACAACACGCCTTGGTCATCGTAGTGGGAGGTACATTTTTGAAACCAAAGAGACTAAACAGGCTGAAGTAAAGGGCAAAAAGATCAAGGATTCCAAAGCTGGCGCTATTACTGAAGCAAAACCATTTTCGCACCTACAGGAATGTGGTCCTCGTTTTACCCTTAAATTGATCAGTCTGCAGCACGGGACATTTGATCCTAGAGGCGGGGAGTTTGAGTGGGTTCACAAGGTAATCCACTTATCAGTCAATTCATTTCAGTATATTGGTTTCATATCTTTATCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Brix

Protein Analysis

192

Amino Acids

22.02

Weight (kDa)

9.5

Isoelectric Point (pI)

29.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Brix PF04427 7 - 98 2.5e-12 Brix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 54
AccB7I CCANNNNNTGG 1 cut(s) 150
AciI CCGC 1 cut(s) 498
AclWI GGATC 2 cut(s) 37, 482
AcsI RAATTY 1 cut(s) 116
AcuI CTGAAG 2 cut(s) 378, 426
AfaI GTAC 2 cut(s) 59, 326
AfiI CCNNNNNNNGG 2 cut(s) 150, 497
AgsI TTSAA 2 cut(s) 85, 335
AluBI AGCT 4 cut(s) 211, 220, 277, 392
AluI AGCT 4 cut(s) 211, 220, 277, 392
Alw26I GTCTC 1 cut(s) 338
AlwI GGATC 2 cut(s) 37, 482
ApeKI GCWGC 1 cut(s) 472
ApoI RAATTY 1 cut(s) 116
AspLEI GCGC 2 cut(s) 55, 398
AspS9I GGNCC 2 cut(s) 11, 440
AsuHPI GGTGA 1 cut(s) 52
AvaII GGWCC 2 cut(s) 11, 440
BbvI GCAGC 1 cut(s) 484
BclI TGATCA 1 cut(s) 462
BcoDI GTCTC 1 cut(s) 338
BfaI CTAG 1 cut(s) 492
BfmI CTRYAG 2 cut(s) 428, 470
BfoI RGCGCY 1 cut(s) 399
BisI GCNGC 1 cut(s) 473
BlsI GCNGC 1 cut(s) 474
BmcAI AGTACT 1 cut(s) 59
Bme18I GGWCC 2 cut(s) 11, 440
BmgT120I GGNCC 2 cut(s) 11, 440
BmiI GGNNCC 2 cut(s) 12, 156
BmsI GCATC 1 cut(s) 151
Bpu10I CCTNAGC 1 cut(s) 273
BsaJI CCNNGG 1 cut(s) 304
BsaXI ACNNNNNCTCC 2 cut(s) 494, 524
Bsc4I CCNNNNNNNGG 2 cut(s) 150, 497
Bse1I ACTGG 1 cut(s) 261
BseDI CCNNGG 1 cut(s) 304
BseLI CCNNNNNNNGG 2 cut(s) 150, 497
BseMII CTCAG 1 cut(s) 264
BseNI ACTGG 1 cut(s) 261
BseXI GCAGC 1 cut(s) 484
BseYI CCCAGC 1 cut(s) 150
BslFI GGGAC 1 cut(s) 493
BslI CCNNNNNNNGG 2 cut(s) 150, 497
BsmAI GTCTC 1 cut(s) 338
BsmFI GGGAC 1 cut(s) 493
Bsp143I GATC 4 cut(s) 42, 375, 462, 487
BspACI CCGC 1 cut(s) 498
BspCNI CTCAG 1 cut(s) 265
BspHI TCATGA 1 cut(s) 265
BspLI GGNNCC 2 cut(s) 12, 156
BspMAI CTGCAG 1 cut(s) 474
BspPI GGATC 2 cut(s) 37, 482
BsrI ACTGG 1 cut(s) 261
BssECI CCNNGG 1 cut(s) 304
BssMI GATC 4 cut(s) 42, 375, 462, 487
BssT1I CCWWGG 1 cut(s) 304
BstC8I GCNNGC 1 cut(s) 394
BstDEI CTNAG 1 cut(s) 273
BstH2I RGCGCY 1 cut(s) 399
BstHHI GCGC 2 cut(s) 55, 398
BstKTI GATC 4 cut(s) 45, 378, 465, 490
BstMAI GTCTC 1 cut(s) 338
BstMBI GATC 4 cut(s) 42, 375, 462, 487
BstMWI GCNNNNNNNGC 1 cut(s) 217
BstSFI CTRYAG 2 cut(s) 428, 470
BstV1I GCAGC 1 cut(s) 484
Cac8I GCNNGC 1 cut(s) 394
CciI TCATGA 1 cut(s) 265
CfoI GCGC 2 cut(s) 55, 398
Cfr13I GGNCC 2 cut(s) 11, 440
Csp6I GTAC 2 cut(s) 58, 325
CviAII CATG 2 cut(s) 248, 266
CviJI RGCY 7 cut(s) 180, 211, 220, 271, 277, 356, 392
CviKI_1 RGCY 7 cut(s) 180, 211, 220, 271, 277, 356, 392
CviQI GTAC 2 cut(s) 58, 325
DdeI CTNAG 1 cut(s) 273
DpnI GATC 4 cut(s) 44, 377, 464, 489
DpnII GATC 4 cut(s) 42, 375, 462, 487
Eco130I CCWWGG 1 cut(s) 304
Eco32I GATATC 1 cut(s) 238
Eco47I GGWCC 2 cut(s) 11, 440
Eco57I CTGAAG 2 cut(s) 378, 426
EcoO109I RGGNCCY 1 cut(s) 11
EcoRI GAATTC 1 cut(s) 116
EcoRV GATATC 1 cut(s) 238
EcoT14I CCWWGG 1 cut(s) 304
ErhI CCWWGG 1 cut(s) 304
FaeI CATG 2 cut(s) 251, 269
FalI AAGNNNNNCTT 2 cut(s) 58, 90
FaqI GGGAC 1 cut(s) 493
FatI CATG 2 cut(s) 247, 265
FauI CCCGC 1 cut(s) 491
FbaI TGATCA 1 cut(s) 462
Fnu4HI GCNGC 1 cut(s) 473
Fsp4HI GCNGC 1 cut(s) 473
FspBI CTAG 1 cut(s) 492
FspI TGCGCA 1 cut(s) 54
GlaI GCGC 2 cut(s) 54, 397
GluI GCNGC 1 cut(s) 473
GsaI CCCAGC 1 cut(s) 154
HaeII RGCGCY 1 cut(s) 399
HhaI GCGC 2 cut(s) 55, 398
Hin1II CATG 2 cut(s) 251, 269
Hin6I GCGC 2 cut(s) 53, 396
HinP1I GCGC 2 cut(s) 53, 396
HindIII AAGCTT 1 cut(s) 218
HinfI GANTC 2 cut(s) 244, 383
HphI GGTGA 1 cut(s) 52
Hpy166II GTNNAC 1 cut(s) 517
Hpy188III TCNNGA 2 cut(s) 241, 266
Hpy8I GTNNAC 1 cut(s) 517
HpyAV CCTTC 1 cut(s) 226
HpyCH4V TGCA 2 cut(s) 104, 472
HpyF10VI GCNNNNNNNGC 1 cut(s) 217
HpyF3I CTNAG 1 cut(s) 273
Hsp92II CATG 2 cut(s) 251, 269
HspAI GCGC 2 cut(s) 53, 396
Ksp22I TGATCA 1 cut(s) 462
Kzo9I GATC 4 cut(s) 42, 375, 462, 487
LpnPI CCDG 8 cut(s) 27, 136, 171, 274, 285, 338, 378, 416
Lsp1109I GCAGC 1 cut(s) 484
LweI GCATC 1 cut(s) 151
MaeI CTAG 1 cut(s) 492
MalI GATC 4 cut(s) 44, 377, 464, 489
MboI GATC 4 cut(s) 42, 375, 462, 487
MluCI AATT 5 cut(s) 116, 129, 171, 458, 541
MmeI TCCRAC 1 cut(s) 281
MnlI CCTC 5 cut(s) 19, 62, 315, 453, 488
MseI TTAA 4 cut(s) 128, 207, 284, 456
MslI CAYNNNNRTG 1 cut(s) 315
MwoI GCNNNNNNNGC 1 cut(s) 217
NdeII GATC 4 cut(s) 42, 375, 462, 487
NlaIII CATG 2 cut(s) 251, 269
NlaIV GGNNCC 2 cut(s) 12, 156
NsbI TGCGCA 1 cut(s) 54
PagI TCATGA 1 cut(s) 265
PfeI GAWTC 2 cut(s) 244, 383
PflMI CCANNNNNTGG 1 cut(s) 150
PkrI GCNGC 1 cut(s) 474
PpuMI RGGWCCY 1 cut(s) 11
Psp5II RGGWCCY 1 cut(s) 11
PspFI CCCAGC 1 cut(s) 150
PspN4I GGNNCC 2 cut(s) 12, 156
PspPI GGNCC 2 cut(s) 11, 440
PspPPI RGGWCCY 1 cut(s) 11
PstI CTGCAG 1 cut(s) 474
RsaI GTAC 2 cut(s) 59, 326
RsaNI GTAC 2 cut(s) 58, 325
RseI CAYNNNNRTG 1 cut(s) 315
SaqAI TTAA 4 cut(s) 128, 207, 284, 456
SatI GCNGC 1 cut(s) 473
Sau3AI GATC 4 cut(s) 42, 375, 462, 487
Sau96I GGNCC 2 cut(s) 11, 440
ScaI AGTACT 1 cut(s) 59
SetI ASST 8 cut(s) 187, 213, 222, 279, 326, 394, 429, 525
SfaNI GCATC 1 cut(s) 151
SfcI CTRYAG 2 cut(s) 428, 470
SinI GGWCC 2 cut(s) 11, 440
SmiMI CAYNNNNRTG 1 cut(s) 315
Sse9I AATT 5 cut(s) 116, 129, 171, 458, 541
SsiI CCGC 1 cut(s) 498
SspMI CTAG 1 cut(s) 492
StyI CCWWGG 1 cut(s) 304
TasI AATT 5 cut(s) 116, 129, 171, 458, 541
TatI WGTACW 1 cut(s) 57
TfiI GAWTC 2 cut(s) 244, 383
Tru1I TTAA 4 cut(s) 128, 207, 284, 456
Tru9I TTAA 4 cut(s) 128, 207, 284, 456
TseI GCWGC 1 cut(s) 472
TspDTI ATGAA 3 cut(s) 128, 534, 553
TspGWI ACGGA 1 cut(s) 244
Van91I CCANNNNNTGG 1 cut(s) 150
VpaK11BI GGWCC 2 cut(s) 11, 440
XapI RAATTY 1 cut(s) 116
XspI CTAG 1 cut(s) 492
ZrmI AGTACT 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.