RchiOBHm_Chr1g0358001

C-terminal binding protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
50178918 .. 50179201
284 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGAAAATGAACACTGATAAACTGGAGCAAGAAAATCCCTTACAGCTAACCCTCATTCAGCAATTAACTGATTTTAGTCATGCAAGTCCAGAAAGCTCCCTGAATAAAGTAACCAATCAATCCAAGGTGTCTCCTAGCCAGCAAGGTTCGGGTTTGTCTCAAAATTCAACTACTCGGTCTGATGGAAGACAAAGTAGATGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.29

Weight (kDa)

8.21

Isoelectric Point (pI)

78.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 163
AgsI TTSAA 1 cut(s) 168
AluBI AGCT 2 cut(s) 46, 96
AluI AGCT 2 cut(s) 46, 96
Alw26I GTCTC 2 cut(s) 135, 162
ApoI RAATTY 1 cut(s) 163
BbsI GAAGAC 1 cut(s) 193
BccI CCATC 1 cut(s) 176
BcoDI GTCTC 2 cut(s) 135, 162
BfaI CTAG 1 cut(s) 135
BpiI GAAGAC 1 cut(s) 193
BpmI CTGGAG 1 cut(s) 44
BsaJI CCNNGG 1 cut(s) 123
Bse1I ACTGG 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 123
BseNI ACTGG 1 cut(s) 27
BsmAI GTCTC 2 cut(s) 135, 162
BsrI ACTGG 1 cut(s) 27
BssECI CCNNGG 1 cut(s) 123
BssT1I CCWWGG 1 cut(s) 123
BstC8I GCNNGC 1 cut(s) 140
BstMAI GTCTC 2 cut(s) 135, 162
BstV2I GAAGAC 1 cut(s) 193
BtsIMutI CAGTG 1 cut(s) 12
Cac8I GCNNGC 1 cut(s) 140
CviAII CATG 1 cut(s) 80
CviJI RGCY 3 cut(s) 46, 96, 138
CviKI_1 RGCY 3 cut(s) 46, 96, 138
Eco130I CCWWGG 1 cut(s) 123
EcoT14I CCWWGG 1 cut(s) 123
ErhI CCWWGG 1 cut(s) 123
FaeI CATG 1 cut(s) 83
FaiI YATR 1 cut(s) 81
FatI CATG 1 cut(s) 79
FspBI CTAG 1 cut(s) 135
GsuI CTGGAG 1 cut(s) 44
Hin1II CATG 1 cut(s) 83
Hpy188I TCNGA 1 cut(s) 181
Hpy188III TCNNGA 1 cut(s) 89
HpyCH4V TGCA 1 cut(s) 83
Hsp92II CATG 1 cut(s) 83
LmnI GCTCC 2 cut(s) 25, 101
LpnPI CCDG 4 cut(s) 8, 102, 113, 152
MaeI CTAG 1 cut(s) 135
MaeIII GTNAC 1 cut(s) 109
MboII GAAGA 1 cut(s) 198
MluCI AATT 2 cut(s) 62, 163
MnlI CCTC 1 cut(s) 62
MseI TTAA 1 cut(s) 65
NlaIII CATG 1 cut(s) 83
SaqAI TTAA 1 cut(s) 65
SetI ASST 4 cut(s) 48, 98, 129, 148
Sse9I AATT 2 cut(s) 62, 163
SspMI CTAG 1 cut(s) 135
StyI CCWWGG 1 cut(s) 123
TaqII GACCGA 1 cut(s) 165
TasI AATT 2 cut(s) 62, 163
Tru1I TTAA 1 cut(s) 65
Tru9I TTAA 1 cut(s) 65
TscAI CASTG 1 cut(s) 19
TspDTI ATGAA 2 cut(s) 17, 23
TspRI CASTG 1 cut(s) 19
XapI RAATTY 1 cut(s) 163
XspI CTAG 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.