Rh5BG417100

C-terminal binding protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
67659078 .. 67660788
1711 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG417100.1

Sequence Viewer

Length: 153 bp
ATGTTGGAAGGATCTCTGGACGAGTGTAGGCTGGTTAACTGTAGAAATCCACTGGCTGTTTTGGATGTAAGCATCGAGATACTGGCCACTGTAGGCGAAGATGATGGGGTAACACGCTGGCTTGATTTGGACTGGAACATGAGATTTGATTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.71

Weight (kDa)

4.07

Isoelectric Point (pI)

52.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 19
AcoI YGGCCR 1 cut(s) 84
AlwI GGATC 1 cut(s) 19
AoxI GGCC 1 cut(s) 84
BalI TGGCCA 1 cut(s) 86
BccI CCATC 1 cut(s) 98
BfmI CTRYAG 2 cut(s) 40, 90
BmsI GCATC 1 cut(s) 81
Bse1I ACTGG 3 cut(s) 57, 87, 137
BseGI GGATG 1 cut(s) 70
BseNI ACTGG 3 cut(s) 57, 87, 137
BshFI GGCC 1 cut(s) 86
BsnI GGCC 1 cut(s) 86
Bsp143I GATC 1 cut(s) 11
BspANI GGCC 1 cut(s) 86
BspPI GGATC 1 cut(s) 19
BsrI ACTGG 3 cut(s) 57, 87, 137
BssMI GATC 1 cut(s) 11
Bst4CI ACNGT 2 cut(s) 41, 91
BstC8I GCNNGC 1 cut(s) 119
BstF5I GGATG 1 cut(s) 70
BstKTI GATC 1 cut(s) 14
BstMBI GATC 1 cut(s) 11
BstSFI CTRYAG 2 cut(s) 40, 90
BstX2I RGATCY 1 cut(s) 11
BstYI RGATCY 1 cut(s) 11
BsuRI GGCC 1 cut(s) 86
BtsCI GGATG 1 cut(s) 70
BtsIMutI CAGTG 2 cut(s) 50, 87
Cac8I GCNNGC 1 cut(s) 119
CviAII CATG 1 cut(s) 139
CviJI RGCY 4 cut(s) 31, 56, 86, 121
CviKI_1 RGCY 4 cut(s) 31, 56, 86, 121
DpnI GATC 1 cut(s) 13
DpnII GATC 1 cut(s) 11
EaeI YGGCCR 1 cut(s) 84
FaeI CATG 1 cut(s) 142
FaiI YATR 1 cut(s) 140
FatI CATG 1 cut(s) 138
FokI GGATG 1 cut(s) 77
HaeIII GGCC 1 cut(s) 86
Hin1II CATG 1 cut(s) 142
HincII GTYRAC 1 cut(s) 37
HindII GTYRAC 1 cut(s) 37
HpaI GTTAAC 1 cut(s) 37
Hpy166II GTNNAC 1 cut(s) 37
Hpy188III TCNNGA 2 cut(s) 17, 76
Hpy8I GTNNAC 1 cut(s) 37
HpyCH4III ACNGT 2 cut(s) 41, 91
Hsp92II CATG 1 cut(s) 142
KspAI GTTAAC 1 cut(s) 37
Kzo9I GATC 1 cut(s) 11
LpnPI CCDG 6 cut(s) 2, 17, 38, 68, 103, 118
LweI GCATC 1 cut(s) 81
MaeIII GTNAC 1 cut(s) 109
MalI GATC 1 cut(s) 13
MboI GATC 1 cut(s) 11
MboII GAAGA 1 cut(s) 110
MflI RGATCY 1 cut(s) 11
MlsI TGGCCA 1 cut(s) 86
MluNI TGGCCA 1 cut(s) 86
Mox20I TGGCCA 1 cut(s) 86
MscI TGGCCA 1 cut(s) 86
MseI TTAA 2 cut(s) 36, 151
Msp20I TGGCCA 1 cut(s) 86
NdeII GATC 1 cut(s) 11
NlaIII CATG 1 cut(s) 142
PsuI RGATCY 1 cut(s) 11
SaqAI TTAA 2 cut(s) 36, 151
Sau3AI GATC 1 cut(s) 11
SfaNI GCATC 1 cut(s) 81
SfcI CTRYAG 2 cut(s) 40, 90
TaaI ACNGT 2 cut(s) 41, 91
TaqI TCGA 1 cut(s) 75
Tru1I TTAA 2 cut(s) 36, 151
Tru9I TTAA 2 cut(s) 36, 151
TscAI CASTG 2 cut(s) 57, 94
TspRI CASTG 2 cut(s) 57, 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.