Rh5CG441600

C-terminal binding protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
61366188 .. 61367615
1428 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG441600.1

Sequence Viewer

Length: 192 bp
ATGTTGGAAGGATCTCTGGACGAGTGTAGGCTGGTTAACTGTAGAAATCCACTGGCTGTTTTGGATGTAAGCATCGAGATACTGGCCACTGTAGGCGAAGATGATGGGGTAACACGCTGGCTTGATTTGGACTGGAACATGAGAGGATTAGCGACTCAAATGGAGGGGTTCAGTGTTTCCAAACTTAAGTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

7.03

Weight (kDa)

4.34

Isoelectric Point (pI)

36.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 19
AcoI YGGCCR 1 cut(s) 84
AflII CTTAAG 1 cut(s) 185
AlwI GGATC 1 cut(s) 19
AoxI GGCC 1 cut(s) 84
BalI TGGCCA 1 cut(s) 86
BccI CCATC 1 cut(s) 98
BfmI CTRYAG 2 cut(s) 40, 90
BfrI CTTAAG 1 cut(s) 185
BmsI GCATC 1 cut(s) 81
Bse1I ACTGG 3 cut(s) 57, 87, 137
BseGI GGATG 1 cut(s) 70
BseNI ACTGG 3 cut(s) 57, 87, 137
BshFI GGCC 1 cut(s) 86
BsnI GGCC 1 cut(s) 86
Bsp143I GATC 1 cut(s) 11
BspANI GGCC 1 cut(s) 86
BspPI GGATC 1 cut(s) 19
BspTI CTTAAG 1 cut(s) 185
BsrI ACTGG 3 cut(s) 57, 87, 137
BssMI GATC 1 cut(s) 11
Bst4CI ACNGT 2 cut(s) 41, 91
BstAFI CTTAAG 1 cut(s) 185
BstC8I GCNNGC 1 cut(s) 119
BstF5I GGATG 1 cut(s) 70
BstKTI GATC 1 cut(s) 14
BstMBI GATC 1 cut(s) 11
BstSFI CTRYAG 2 cut(s) 40, 90
BstX2I RGATCY 1 cut(s) 11
BstYI RGATCY 1 cut(s) 11
BsuRI GGCC 1 cut(s) 86
BtsCI GGATG 1 cut(s) 70
BtsIMutI CAGTG 3 cut(s) 50, 87, 178
Cac8I GCNNGC 1 cut(s) 119
CviAII CATG 1 cut(s) 139
CviJI RGCY 4 cut(s) 31, 56, 86, 121
CviKI_1 RGCY 4 cut(s) 31, 56, 86, 121
DpnI GATC 1 cut(s) 13
DpnII GATC 1 cut(s) 11
EaeI YGGCCR 1 cut(s) 84
FaeI CATG 1 cut(s) 142
FaiI YATR 1 cut(s) 140
FatI CATG 1 cut(s) 138
FokI GGATG 1 cut(s) 77
HaeIII GGCC 1 cut(s) 86
Hin1II CATG 1 cut(s) 142
HincII GTYRAC 1 cut(s) 37
HindII GTYRAC 1 cut(s) 37
HinfI GANTC 1 cut(s) 154
HpaI GTTAAC 1 cut(s) 37
Hpy166II GTNNAC 1 cut(s) 37
Hpy188III TCNNGA 2 cut(s) 17, 76
Hpy8I GTNNAC 1 cut(s) 37
HpyCH4III ACNGT 2 cut(s) 41, 91
Hsp92II CATG 1 cut(s) 142
KspAI GTTAAC 1 cut(s) 37
Kzo9I GATC 1 cut(s) 11
LpnPI CCDG 6 cut(s) 2, 17, 38, 68, 103, 118
LweI GCATC 1 cut(s) 81
MaeIII GTNAC 1 cut(s) 109
MalI GATC 1 cut(s) 13
MboI GATC 1 cut(s) 11
MboII GAAGA 1 cut(s) 110
MflI RGATCY 1 cut(s) 11
MlsI TGGCCA 1 cut(s) 86
MluNI TGGCCA 1 cut(s) 86
MlyI GAGTC 1 cut(s) 148
MnlI CCTC 2 cut(s) 137, 157
Mox20I TGGCCA 1 cut(s) 86
MscI TGGCCA 1 cut(s) 86
MseI TTAA 2 cut(s) 36, 186
Msp20I TGGCCA 1 cut(s) 86
MspCI CTTAAG 1 cut(s) 185
NdeII GATC 1 cut(s) 11
NlaIII CATG 1 cut(s) 142
PleI GAGTC 1 cut(s) 148
PpsI GAGTC 1 cut(s) 148
PsuI RGATCY 1 cut(s) 11
SaqAI TTAA 2 cut(s) 36, 186
Sau3AI GATC 1 cut(s) 11
SchI GAGTC 1 cut(s) 148
SfaNI GCATC 1 cut(s) 81
SfcI CTRYAG 2 cut(s) 40, 90
SmlI CTYRAG 1 cut(s) 185
SmoI CTYRAG 1 cut(s) 185
TaaI ACNGT 2 cut(s) 41, 91
TaqI TCGA 1 cut(s) 75
Tru1I TTAA 2 cut(s) 36, 186
Tru9I TTAA 2 cut(s) 36, 186
TscAI CASTG 3 cut(s) 57, 94, 178
TspRI CASTG 3 cut(s) 57, 94, 178
Vha464I CTTAAG 1 cut(s) 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.