Rh4CG143200

C-terminal binding protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
28736317 .. 28736928
612 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG143200.1

Sequence Viewer

Length: 177 bp
ATGGAATTTGTATTTGCAAGTCACAGTTTTGATGTTTGGGAGAGTTGGATGTTGGAAGGTTCTCTGGACGAGTGTAGGCTGGTTAACTGTAGAAATCCACTAGCTGTTTTGGATGTAAGCATTGAGATACTGGCCACTGTAGGTGAAGATGATGGGGTAACACGCTGGCTTGATTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.62

Weight (kDa)

4.06

Isoelectric Point (pI)

53.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 132
AcsI RAATTY 1 cut(s) 5
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
AoxI GGCC 1 cut(s) 132
ApoI RAATTY 1 cut(s) 5
AsuHPI GGTGA 1 cut(s) 155
BalI TGGCCA 1 cut(s) 134
BccI CCATC 1 cut(s) 146
BfaI CTAG 1 cut(s) 101
BfmI CTRYAG 2 cut(s) 88, 138
Bse1I ACTGG 1 cut(s) 135
BseGI GGATG 2 cut(s) 54, 118
BseNI ACTGG 1 cut(s) 135
BshFI GGCC 1 cut(s) 134
BsnI GGCC 1 cut(s) 134
BspANI GGCC 1 cut(s) 134
BsrI ACTGG 1 cut(s) 135
Bst4CI ACNGT 3 cut(s) 26, 89, 139
BstC8I GCNNGC 1 cut(s) 167
BstF5I GGATG 2 cut(s) 54, 118
BstSFI CTRYAG 2 cut(s) 88, 138
BsuRI GGCC 1 cut(s) 134
BtsCI GGATG 2 cut(s) 54, 118
BtsIMutI CAGTG 1 cut(s) 135
Cac8I GCNNGC 1 cut(s) 167
CviJI RGCY 4 cut(s) 79, 104, 134, 169
CviKI_1 RGCY 4 cut(s) 79, 104, 134, 169
EaeI YGGCCR 1 cut(s) 132
FokI GGATG 2 cut(s) 61, 125
FspBI CTAG 1 cut(s) 101
HaeIII GGCC 1 cut(s) 134
HincII GTYRAC 1 cut(s) 85
HindII GTYRAC 1 cut(s) 85
HpaI GTTAAC 1 cut(s) 85
HphI GGTGA 1 cut(s) 155
Hpy166II GTNNAC 1 cut(s) 85
Hpy188III TCNNGA 1 cut(s) 65
Hpy8I GTNNAC 1 cut(s) 85
HpyAV CCTTC 1 cut(s) 50
HpyCH4III ACNGT 3 cut(s) 26, 89, 139
HpyCH4V TGCA 1 cut(s) 17
KspAI GTTAAC 1 cut(s) 85
LpnPI CCDG 4 cut(s) 50, 65, 116, 151
MaeI CTAG 1 cut(s) 101
MaeIII GTNAC 2 cut(s) 20, 157
MboII GAAGA 1 cut(s) 158
MlsI TGGCCA 1 cut(s) 134
MluCI AATT 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 134
MmeI TCCRAC 2 cut(s) 26, 33
Mox20I TGGCCA 1 cut(s) 134
MscI TGGCCA 1 cut(s) 134
MseI TTAA 1 cut(s) 84
Msp20I TGGCCA 1 cut(s) 134
NmuCI GTSAC 1 cut(s) 20
SaqAI TTAA 1 cut(s) 84
SetI ASST 3 cut(s) 61, 106, 145
SfcI CTRYAG 2 cut(s) 88, 138
SgeI CNNG 6 cut(s) 30, 77, 82, 92, 113, 143
Sse9I AATT 1 cut(s) 5
SspMI CTAG 1 cut(s) 101
TaaI ACNGT 3 cut(s) 26, 89, 139
TasI AATT 1 cut(s) 5
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TscAI CASTG 1 cut(s) 142
TseFI GTSAC 1 cut(s) 20
Tsp45I GTSAC 1 cut(s) 20
TspRI CASTG 1 cut(s) 142
XapI RAATTY 1 cut(s) 5
XspI CTAG 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.