Rh6BG411700

C-terminal binding protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
63729229 .. 63730483
1255 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG411700.1

Sequence Viewer

Length: 204 bp
ATGTCTAATTTATTGATAAATAGAAGAATGAAATTTGTATTCGCAAGTCACAGTTTTGATGTTTGGGAGAGTTGGATGTTGGAAGGTTCTCTGGACGAGTGTAGGCTGGTTAACTGTAGAAATCCACTGGCTGTTTTGGATGTAAGCATCGAGATACTGGCCACTGTAGGCGAAGATGATGGGGTAACACGCTGGCTTGATTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.71

Weight (kDa)

4.57

Isoelectric Point (pI)

62.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 159
AcsI RAATTY 1 cut(s) 32
AoxI GGCC 1 cut(s) 159
ApoI RAATTY 1 cut(s) 32
BalI TGGCCA 1 cut(s) 161
BccI CCATC 1 cut(s) 173
BfmI CTRYAG 2 cut(s) 115, 165
BmsI GCATC 1 cut(s) 156
Bse1I ACTGG 2 cut(s) 132, 162
BseGI GGATG 2 cut(s) 81, 145
BseNI ACTGG 2 cut(s) 132, 162
BshFI GGCC 1 cut(s) 161
BsnI GGCC 1 cut(s) 161
BspANI GGCC 1 cut(s) 161
BsrI ACTGG 2 cut(s) 132, 162
Bst4CI ACNGT 3 cut(s) 53, 116, 166
BstC8I GCNNGC 1 cut(s) 194
BstF5I GGATG 2 cut(s) 81, 145
BstSFI CTRYAG 2 cut(s) 115, 165
BsuRI GGCC 1 cut(s) 161
BtsCI GGATG 2 cut(s) 81, 145
BtsIMutI CAGTG 2 cut(s) 125, 162
Cac8I GCNNGC 1 cut(s) 194
CviJI RGCY 4 cut(s) 106, 131, 161, 196
CviKI_1 RGCY 4 cut(s) 106, 131, 161, 196
EaeI YGGCCR 1 cut(s) 159
FokI GGATG 2 cut(s) 88, 152
HaeIII GGCC 1 cut(s) 161
HincII GTYRAC 1 cut(s) 112
HindII GTYRAC 1 cut(s) 112
HpaI GTTAAC 1 cut(s) 112
Hpy166II GTNNAC 1 cut(s) 112
Hpy188III TCNNGA 2 cut(s) 92, 151
Hpy8I GTNNAC 1 cut(s) 112
HpyAV CCTTC 1 cut(s) 77
HpyCH4III ACNGT 3 cut(s) 53, 116, 166
KspAI GTTAAC 1 cut(s) 112
LpnPI CCDG 5 cut(s) 77, 92, 113, 143, 178
LweI GCATC 1 cut(s) 156
MaeIII GTNAC 2 cut(s) 47, 184
MboII GAAGA 2 cut(s) 36, 185
MlsI TGGCCA 1 cut(s) 161
MluCI AATT 2 cut(s) 7, 32
MluNI TGGCCA 1 cut(s) 161
MmeI TCCRAC 2 cut(s) 53, 60
Mox20I TGGCCA 1 cut(s) 161
MscI TGGCCA 1 cut(s) 161
MseI TTAA 1 cut(s) 111
Msp20I TGGCCA 1 cut(s) 161
NmuCI GTSAC 1 cut(s) 47
SaqAI TTAA 1 cut(s) 111
SetI ASST 1 cut(s) 88
SfaNI GCATC 1 cut(s) 156
SfcI CTRYAG 2 cut(s) 115, 165
SgeI CNNG 7 cut(s) 57, 104, 109, 119, 140, 163, 170
Sse9I AATT 2 cut(s) 7, 32
TaaI ACNGT 3 cut(s) 53, 116, 166
TaqI TCGA 1 cut(s) 150
TasI AATT 2 cut(s) 7, 32
Tru1I TTAA 1 cut(s) 111
Tru9I TTAA 1 cut(s) 111
TscAI CASTG 2 cut(s) 132, 169
TseFI GTSAC 1 cut(s) 47
Tsp45I GTSAC 1 cut(s) 47
TspDTI ATGAA 1 cut(s) 44
TspRI CASTG 2 cut(s) 132, 169
XapI RAATTY 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.