RchiOBHm_Chr1g0358071

C-terminal binding protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
50194337 .. 50195571
1235 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58326

Sequence Viewer

Length: 204 bp
ATGGAAGCATGGGAAAAGGAGATGCCCAATGTGTTAATACTTCCGTACAATGCAGATTATAGCGAAGAAGTATGGTTGGAGATAAGGGAGAAAGCAATATCCGTATTGCAGACATTCTTCTTTGATGGGGTTGTTCCAAAAAATGTTGTATCAGATGAGGACGAGGAGGATAGTGAAATAGGTGATGAAAATGAACACTGCTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.82

Weight (kDa)

4.05

Isoelectric Point (pI)

62.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 47
AsuHPI GGTGA 1 cut(s) 194
BccI CCATC 1 cut(s) 119
BmsI GCATC 1 cut(s) 12
BseRI GAGGAG 1 cut(s) 179
BtsI GCAGTG 1 cut(s) 196
BtsIMutI CAGTG 1 cut(s) 196
Csp6I GTAC 1 cut(s) 46
CviAII CATG 1 cut(s) 9
CviQI GTAC 1 cut(s) 46
FaeI CATG 1 cut(s) 12
FaiI YATR 3 cut(s) 10, 60, 73
FatI CATG 1 cut(s) 8
Hin1II CATG 1 cut(s) 12
HphI GGTGA 1 cut(s) 194
Hpy188I TCNGA 1 cut(s) 154
HpyCH4V TGCA 2 cut(s) 53, 109
Hsp92II CATG 1 cut(s) 12
LweI GCATC 1 cut(s) 12
MboII GAAGA 2 cut(s) 77, 109
MmeI TCCRAC 1 cut(s) 57
MnlI CCTC 3 cut(s) 151, 157, 160
MseI TTAA 1 cut(s) 35
NlaIII CATG 1 cut(s) 12
RsaI GTAC 1 cut(s) 47
RsaNI GTAC 1 cut(s) 46
SaqAI TTAA 1 cut(s) 35
SetI ASST 1 cut(s) 184
SfaNI GCATC 1 cut(s) 12
SgeI CNNG 2 cut(s) 21, 175
Tru1I TTAA 1 cut(s) 35
Tru9I TTAA 1 cut(s) 35
TscAI CASTG 1 cut(s) 203
TspDTI ATGAA 1 cut(s) 201
TspGWI ACGGA 2 cut(s) 33, 91
TspRI CASTG 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.