RchiOBHm_Chr1g0347201

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
39826510 .. 39830492
3983 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57335

Sequence Viewer

Length: 234 bp
ATGCTGTTAGAGGCGAGTTGTATCTTCAAGCTTCTGAGCTTCAGAAGGAAGGAAAGAAGAAAGCATTTATATCCCTTCACCGAGAAGTCCATTAAGCTTCTGATGGATAAGAAGCAGAAGGCAGAGAAGTCTTTGAAAATTGAAAAGGAGATGACACAATCCCAGGCTAATGAATTGGCCTCCCTTAGGCATGCAACTCTAAGTTCAATTCTAGTTAATCATCTTTTGCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

9.05

Weight (kDa)

10.01

Isoelectric Point (pI)

52.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 25
AfiI CCNNNNNNNGG 1 cut(s) 186
AgsI TTSAA 4 cut(s) 28, 136, 143, 207
AjnI CCWGG 1 cut(s) 162
AluBI AGCT 3 cut(s) 31, 39, 97
AluI AGCT 3 cut(s) 31, 39, 97
AoxI GGCC 1 cut(s) 177
AsuHPI GGTGA 1 cut(s) 70
AxyI CCTNAGG 1 cut(s) 185
BccI CCATC 1 cut(s) 97
BciT130I CCWGG 1 cut(s) 164
BfaI CTAG 1 cut(s) 212
BfmI CTRYAG 1 cut(s) 230
Bme1390I CCNGG 1 cut(s) 164
BmrFI CCNGG 1 cut(s) 164
BsaJI CCNNGG 1 cut(s) 162
Bsc4I CCNNNNNNNGG 1 cut(s) 186
Bse21I CCTNAGG 1 cut(s) 185
BseBI CCWGG 1 cut(s) 164
BseDI CCNNGG 1 cut(s) 162
BseLI CCNNNNNNNGG 1 cut(s) 186
BseMII CTCAG 1 cut(s) 26
BshFI GGCC 1 cut(s) 179
BslI CCNNNNNNNGG 1 cut(s) 186
BsnI GGCC 1 cut(s) 179
BspANI GGCC 1 cut(s) 179
BspCNI CTCAG 1 cut(s) 27
BssECI CCNNGG 1 cut(s) 162
Bst2UI CCWGG 1 cut(s) 164
BstC8I GCNNGC 1 cut(s) 192
BstDEI CTNAG 3 cut(s) 35, 185, 200
BstENI CCTNNNNNAGG 1 cut(s) 184
BstNI CCWGG 1 cut(s) 164
BstNSI RCATGY 1 cut(s) 194
BstSCI CCNGG 1 cut(s) 162
BstSFI CTRYAG 1 cut(s) 230
Bsu36I CCTNAGG 1 cut(s) 185
BsuRI GGCC 1 cut(s) 179
Cac8I GCNNGC 1 cut(s) 192
CviAII CATG 1 cut(s) 191
CviJI RGCY 5 cut(s) 31, 39, 97, 167, 179
CviKI_1 RGCY 5 cut(s) 31, 39, 97, 167, 179
DdeI CTNAG 3 cut(s) 35, 185, 200
Eco57I CTGAAG 1 cut(s) 25
Eco81I CCTNAGG 1 cut(s) 185
EcoNI CCTNNNNNAGG 1 cut(s) 184
EcoRII CCWGG 1 cut(s) 162
FaeI CATG 1 cut(s) 194
FaiI YATR 2 cut(s) 70, 192
FatI CATG 1 cut(s) 190
FspBI CTAG 1 cut(s) 212
HaeIII GGCC 1 cut(s) 179
Hin1II CATG 1 cut(s) 194
HindIII AAGCTT 2 cut(s) 29, 95
HphI GGTGA 1 cut(s) 70
Hpy188I TCNGA 3 cut(s) 36, 44, 102
HpyAV CCTTC 4 cut(s) 39, 43, 85, 112
HpyCH4V TGCA 1 cut(s) 194
HpyF3I CTNAG 3 cut(s) 35, 185, 200
Hsp92II CATG 1 cut(s) 194
LpnPI CCDG 2 cut(s) 149, 176
MaeI CTAG 1 cut(s) 212
MboII GAAGA 2 cut(s) 16, 69
MluCI AATT 3 cut(s) 138, 173, 207
MnlI CCTC 2 cut(s) 4, 190
MseI TTAA 2 cut(s) 93, 216
MspR9I CCNGG 1 cut(s) 164
MvaI CCWGG 1 cut(s) 164
NlaIII CATG 1 cut(s) 194
NspI RCATGY 1 cut(s) 194
PaeI GCATGC 1 cut(s) 194
Psp6I CCWGG 1 cut(s) 162
PspGI CCWGG 1 cut(s) 162
SaqAI TTAA 2 cut(s) 93, 216
ScrFI CCNGG 1 cut(s) 164
SetI ASST 3 cut(s) 33, 41, 99
SfcI CTRYAG 1 cut(s) 230
SgeI CNNG 7 cut(s) 27, 40, 94, 175, 176, 203, 224
SphI GCATGC 1 cut(s) 194
Sse9I AATT 3 cut(s) 138, 173, 207
SspMI CTAG 1 cut(s) 212
StyD4I CCNGG 1 cut(s) 162
TasI AATT 3 cut(s) 138, 173, 207
Tru1I TTAA 2 cut(s) 93, 216
Tru9I TTAA 2 cut(s) 93, 216
TspDTI ATGAA 1 cut(s) 186
XagI CCTNNNNNAGG 1 cut(s) 184
XceI RCATGY 1 cut(s) 194
XspI CTAG 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.