Rh1CG345900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0001786
Physical Location & Seq
Forward (+)
62335379 .. 62336323
945 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG345900.1

Sequence Viewer

Length: 402 bp
ATGCCGTGTCAGGTGGACAAAGTCTTGGAGTTTAGTCAGGATCAAGAAGAAAGGACTTTCAGGAATGAACATTCTACGGAATACCAGAAGCTTCTGATGGAAGAGGAGCAGATGGCAGAAGAATTGAAGCTGTGTCTGGAAATTGGAAAGGACAGGTTCCAATCACAAGCTTATGAACCAACTTTTGTTGGGTCAATCAAAGAAGTGCAATGTACCGACTTTCAGAGGTCCTCCTTTGATGAAAAATGCATAGAGTCCATTAAGCTTCTGATGGATGAGAAGCAGAAGGCAGAGGAGTCTTTGAAAATTGAAAAGGAGATGACGCGATCCCAGGCTAATGAACTGGCTTCCCTTAGGCATGCAACTCTAAGTTCAATTCTAGTTAATCATCTTTTGCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

133

Amino Acids

15.58

Weight (kDa)

4.82

Isoelectric Point (pI)

61.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 325
AclWI GGATC 2 cut(s) 48, 321
AfaI GTAC 1 cut(s) 214
AgsI TTSAA 4 cut(s) 127, 304, 311, 375
AjnI CCWGG 1 cut(s) 330
AluBI AGCT 4 cut(s) 91, 130, 170, 265
AluI AGCT 4 cut(s) 91, 130, 170, 265
AlwI GGATC 2 cut(s) 48, 321
AspS9I GGNCC 1 cut(s) 228
AvaII GGWCC 1 cut(s) 228
AxyI CCTNAGG 1 cut(s) 353
BccI CCATC 3 cut(s) 91, 106, 265
BciT130I CCWGG 1 cut(s) 332
BfaI CTAG 1 cut(s) 380
BfmI CTRYAG 1 cut(s) 398
Bme1390I CCNGG 1 cut(s) 332
Bme18I GGWCC 1 cut(s) 228
BmgT120I GGNCC 1 cut(s) 228
BmiI GGNNCC 1 cut(s) 158
BmrFI CCNGG 1 cut(s) 332
BsaJI CCNNGG 1 cut(s) 330
Bse1I ACTGG 1 cut(s) 348
Bse21I CCTNAGG 1 cut(s) 353
Bse3DI GCAATG 1 cut(s) 215
BseBI CCWGG 1 cut(s) 332
BseDI CCNNGG 1 cut(s) 330
BseGI GGATG 1 cut(s) 280
BseMI GCAATG 1 cut(s) 215
BseNI ACTGG 1 cut(s) 348
BseRI GAGGAG 2 cut(s) 119, 308
Bsh1236I CGCG 1 cut(s) 325
Bsp143I GATC 2 cut(s) 40, 326
BspFNI CGCG 1 cut(s) 325
BspLI GGNNCC 1 cut(s) 158
BspPI GGATC 2 cut(s) 48, 321
BsrDI GCAATG 1 cut(s) 215
BsrI ACTGG 1 cut(s) 348
BssECI CCNNGG 1 cut(s) 330
BssMI GATC 2 cut(s) 40, 326
Bst2UI CCWGG 1 cut(s) 332
Bst6I CTCTTC 1 cut(s) 96
BstC8I GCNNGC 1 cut(s) 360
BstDEI CTNAG 2 cut(s) 353, 368
BstF5I GGATG 1 cut(s) 280
BstFNI CGCG 1 cut(s) 325
BstKTI GATC 2 cut(s) 43, 329
BstMBI GATC 2 cut(s) 40, 326
BstNI CCWGG 1 cut(s) 332
BstNSI RCATGY 1 cut(s) 362
BstSCI CCNGG 1 cut(s) 330
BstSFI CTRYAG 1 cut(s) 398
BstUI CGCG 1 cut(s) 325
Bsu36I CCTNAGG 1 cut(s) 353
BtsCI GGATG 1 cut(s) 280
Cac8I GCNNGC 1 cut(s) 360
Cfr13I GGNCC 1 cut(s) 228
CseI GACGC 1 cut(s) 331
Csp6I GTAC 1 cut(s) 213
CviAII CATG 1 cut(s) 359
CviJI RGCY 6 cut(s) 91, 130, 170, 265, 335, 347
CviKI_1 RGCY 6 cut(s) 91, 130, 170, 265, 335, 347
CviQI GTAC 1 cut(s) 213
DdeI CTNAG 2 cut(s) 353, 368
DpnI GATC 2 cut(s) 42, 328
DpnII GATC 2 cut(s) 40, 326
Eam1104I CTCTTC 1 cut(s) 96
EarI CTCTTC 1 cut(s) 96
Eco47I GGWCC 1 cut(s) 228
Eco81I CCTNAGG 1 cut(s) 353
EcoO109I RGGNCCY 1 cut(s) 228
EcoRII CCWGG 1 cut(s) 330
EcoT22I ATGCAT 1 cut(s) 251
FaeI CATG 1 cut(s) 362
FaiI YATR 3 cut(s) 174, 251, 360
FatI CATG 1 cut(s) 358
FokI GGATG 1 cut(s) 287
FspBI CTAG 1 cut(s) 380
HgaI GACGC 1 cut(s) 331
Hin1II CATG 1 cut(s) 362
HindIII AAGCTT 3 cut(s) 89, 168, 263
HinfI GANTC 2 cut(s) 254, 296
Hpy166II GTNNAC 1 cut(s) 16
Hpy188I TCNGA 3 cut(s) 96, 225, 270
Hpy188III TCNNGA 4 cut(s) 38, 44, 61, 137
Hpy8I GTNNAC 1 cut(s) 16
HpyAV CCTTC 1 cut(s) 280
HpyCH4V TGCA 3 cut(s) 208, 249, 362
HpyF3I CTNAG 2 cut(s) 353, 368
Hsp92II CATG 1 cut(s) 362
Kzo9I GATC 2 cut(s) 40, 326
LmnI GCTCC 1 cut(s) 106
LpnPI CCDG 8 cut(s) 23, 46, 98, 122, 139, 317, 329, 344
MaeI CTAG 1 cut(s) 380
MalI GATC 2 cut(s) 42, 328
MboI GATC 2 cut(s) 40, 326
MboII GAAGA 3 cut(s) 59, 113, 131
MluCI AATT 4 cut(s) 122, 141, 306, 375
MlyI GAGTC 2 cut(s) 263, 305
MnlI CCTC 4 cut(s) 97, 219, 241, 286
Mph1103I ATGCAT 1 cut(s) 251
MseI TTAA 2 cut(s) 261, 384
MspR9I CCNGG 1 cut(s) 332
MvaI CCWGG 1 cut(s) 332
MvnI CGCG 1 cut(s) 325
NdeII GATC 2 cut(s) 40, 326
NlaIII CATG 1 cut(s) 362
NlaIV GGNNCC 1 cut(s) 158
NsiI ATGCAT 1 cut(s) 251
NspI RCATGY 1 cut(s) 362
PaeI GCATGC 1 cut(s) 362
PflFI GACNNNGTC 1 cut(s) 20
PleI GAGTC 2 cut(s) 262, 304
PpsI GAGTC 2 cut(s) 262, 304
PpuMI RGGWCCY 1 cut(s) 228
Psp5II RGGWCCY 1 cut(s) 228
Psp6I CCWGG 1 cut(s) 330
PspGI CCWGG 1 cut(s) 330
PspN4I GGNNCC 1 cut(s) 158
PspPI GGNCC 1 cut(s) 228
PspPPI RGGWCCY 1 cut(s) 228
PsyI GACNNNGTC 1 cut(s) 20
RsaI GTAC 1 cut(s) 214
RsaNI GTAC 1 cut(s) 213
SaqAI TTAA 2 cut(s) 261, 384
Sau3AI GATC 2 cut(s) 40, 326
Sau96I GGNCC 1 cut(s) 228
SchI GAGTC 2 cut(s) 263, 305
ScrFI CCNGG 1 cut(s) 332
SetI ASST 7 cut(s) 15, 93, 132, 158, 172, 230, 267
SfcI CTRYAG 1 cut(s) 398
SinI GGWCC 1 cut(s) 228
SphI GCATGC 1 cut(s) 362
Sse9I AATT 4 cut(s) 122, 141, 306, 375
SspMI CTAG 1 cut(s) 380
StyD4I CCNGG 1 cut(s) 330
TasI AATT 4 cut(s) 122, 141, 306, 375
Tru1I TTAA 2 cut(s) 261, 384
Tru9I TTAA 2 cut(s) 261, 384
TspDTI ATGAA 4 cut(s) 81, 189, 255, 354
TspGWI ACGGA 1 cut(s) 92
Tth111I GACNNNGTC 1 cut(s) 20
VpaK11BI GGWCC 1 cut(s) 228
XceI RCATGY 1 cut(s) 362
XspI CTAG 1 cut(s) 380
Zsp2I ATGCAT 1 cut(s) 251
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.