Rh1AG203000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
38531492 .. 38531851
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG203000.1

Sequence Viewer

Length: 360 bp
ATGCTGTTAGAGGCGAGTTGTATCTTCAAGCTTCTGAGCTTCAGAAGGAAGGAAAGAAGGTATAAAGACCAGTTTTGTTTGGTTCTTTTGTTTGGTAATTTAGTTGTTCTTGCTTGCACCCTTGGAAAATGGGTCTGCAATGCTATTTTGCTTCGTCTTTCTTTGACTTTCTTGATCAATTTCAAAAAGCATCTATATCCCTTCACCGAGAAGTCCATTAAGCTTCTGATGGATGAGAAGCAGAAGGCAGAGAAGTCTTTGAAAATTGAAAAGGAGATGACGCAATCCCAGGCTAATGAATTGGCCTCCCTTAGGCATGCAACTCTAAGTTCAATTCTAGTTAATCATCTTTTGCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

13.84

Weight (kDa)

9.66

Isoelectric Point (pI)

44.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 25
AfiI CCNNNNNNNGG 1 cut(s) 312
AgsI TTSAA 5 cut(s) 28, 184, 262, 269, 333
AjnI CCWGG 1 cut(s) 288
AluBI AGCT 3 cut(s) 31, 39, 223
AluI AGCT 3 cut(s) 31, 39, 223
AoxI GGCC 1 cut(s) 303
AsuHPI GGTGA 1 cut(s) 196
AxyI CCTNAGG 1 cut(s) 311
BccI CCATC 1 cut(s) 223
BciT130I CCWGG 1 cut(s) 290
BclI TGATCA 1 cut(s) 174
BfaI CTAG 1 cut(s) 338
BfmI CTRYAG 1 cut(s) 356
Bme1390I CCNGG 1 cut(s) 290
BmrFI CCNGG 1 cut(s) 290
BmsI GCATC 1 cut(s) 199
BsaJI CCNNGG 2 cut(s) 121, 288
Bsc4I CCNNNNNNNGG 1 cut(s) 312
Bse1I ACTGG 1 cut(s) 70
Bse21I CCTNAGG 1 cut(s) 311
Bse3DI GCAATG 1 cut(s) 145
BseBI CCWGG 1 cut(s) 290
BseDI CCNNGG 2 cut(s) 121, 288
BseGI GGATG 1 cut(s) 238
BseLI CCNNNNNNNGG 1 cut(s) 312
BseMI GCAATG 1 cut(s) 145
BseMII CTCAG 1 cut(s) 26
BseNI ACTGG 1 cut(s) 70
BshFI GGCC 1 cut(s) 305
BslI CCNNNNNNNGG 1 cut(s) 312
BsnI GGCC 1 cut(s) 305
Bsp143I GATC 1 cut(s) 174
BspANI GGCC 1 cut(s) 305
BspCNI CTCAG 1 cut(s) 27
BsrDI GCAATG 1 cut(s) 145
BsrI ACTGG 1 cut(s) 70
BssECI CCNNGG 2 cut(s) 121, 288
BssMI GATC 1 cut(s) 174
BssT1I CCWWGG 1 cut(s) 121
Bst2UI CCWGG 1 cut(s) 290
BstC8I GCNNGC 2 cut(s) 115, 318
BstDEI CTNAG 3 cut(s) 35, 311, 326
BstENI CCTNNNNNAGG 1 cut(s) 310
BstF5I GGATG 1 cut(s) 238
BstKTI GATC 1 cut(s) 177
BstMBI GATC 1 cut(s) 174
BstNI CCWGG 1 cut(s) 290
BstNSI RCATGY 1 cut(s) 320
BstSCI CCNGG 1 cut(s) 288
BstSFI CTRYAG 1 cut(s) 356
Bsu36I CCTNAGG 1 cut(s) 311
BsuRI GGCC 1 cut(s) 305
BtsCI GGATG 1 cut(s) 238
Cac8I GCNNGC 2 cut(s) 115, 318
CseI GACGC 1 cut(s) 289
CviAII CATG 1 cut(s) 317
CviJI RGCY 5 cut(s) 31, 39, 223, 293, 305
CviKI_1 RGCY 5 cut(s) 31, 39, 223, 293, 305
DdeI CTNAG 3 cut(s) 35, 311, 326
DpnI GATC 1 cut(s) 176
DpnII GATC 1 cut(s) 174
Eco130I CCWWGG 1 cut(s) 121
Eco57I CTGAAG 1 cut(s) 25
Eco81I CCTNAGG 1 cut(s) 311
EcoNI CCTNNNNNAGG 1 cut(s) 310
EcoRII CCWGG 1 cut(s) 288
EcoT14I CCWWGG 1 cut(s) 121
ErhI CCWWGG 1 cut(s) 121
FaeI CATG 1 cut(s) 320
FaiI YATR 3 cut(s) 63, 196, 318
FatI CATG 1 cut(s) 316
FbaI TGATCA 1 cut(s) 174
FokI GGATG 1 cut(s) 245
FspBI CTAG 1 cut(s) 338
HaeIII GGCC 1 cut(s) 305
HgaI GACGC 1 cut(s) 289
Hin1II CATG 1 cut(s) 320
HindIII AAGCTT 2 cut(s) 29, 221
HphI GGTGA 1 cut(s) 196
Hpy188I TCNGA 3 cut(s) 36, 44, 228
Hpy188III TCNNGA 1 cut(s) 172
HpyAV CCTTC 5 cut(s) 39, 43, 51, 211, 238
HpyCH4V TGCA 3 cut(s) 117, 138, 320
HpyF3I CTNAG 3 cut(s) 35, 311, 326
Hsp92II CATG 1 cut(s) 320
Ksp22I TGATCA 1 cut(s) 174
Kzo9I GATC 1 cut(s) 174
LpnPI CCDG 3 cut(s) 83, 275, 302
LweI GCATC 1 cut(s) 199
MaeI CTAG 1 cut(s) 338
MalI GATC 1 cut(s) 176
MboI GATC 1 cut(s) 174
MboII GAAGA 1 cut(s) 16
MluCI AATT 5 cut(s) 97, 178, 264, 299, 333
MnlI CCTC 2 cut(s) 4, 316
MseI TTAA 2 cut(s) 219, 342
MspR9I CCNGG 1 cut(s) 290
MvaI CCWGG 1 cut(s) 290
NdeII GATC 1 cut(s) 174
NlaIII CATG 1 cut(s) 320
NspI RCATGY 1 cut(s) 320
PaeI GCATGC 1 cut(s) 320
Psp6I CCWGG 1 cut(s) 288
PspGI CCWGG 1 cut(s) 288
SaqAI TTAA 2 cut(s) 219, 342
Sau3AI GATC 1 cut(s) 174
ScrFI CCNGG 1 cut(s) 290
SetI ASST 4 cut(s) 33, 41, 62, 225
SfaNI GCATC 1 cut(s) 199
SfcI CTRYAG 1 cut(s) 356
SphI GCATGC 1 cut(s) 320
Sse9I AATT 5 cut(s) 97, 178, 264, 299, 333
SspMI CTAG 1 cut(s) 338
StyD4I CCNGG 1 cut(s) 288
StyI CCWWGG 1 cut(s) 121
TasI AATT 5 cut(s) 97, 178, 264, 299, 333
Tru1I TTAA 2 cut(s) 219, 342
Tru9I TTAA 2 cut(s) 219, 342
TspDTI ATGAA 1 cut(s) 312
XagI CCTNNNNNAGG 1 cut(s) 310
XceI RCATGY 1 cut(s) 320
XspI CTAG 1 cut(s) 338
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.