Rmu_sc0009615.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009615.1
Physical Location & Seq
Forward (+)
28 .. 1471
1444 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009615.1_g000001.1.cds

Sequence Viewer

Length: 540 bp
atggatgagaagcagaaggcagaggagtctttgaaaattgaaaaggagatgacgggatcccaggctaaggaactggcttcccttagatctgccttaaatgaaaagtgcaccgagtggcaggagcttctaagggaagagaaggagaaggcagagaagttaatgctacttttggaaattgaaaaggagagaacacaggctgatgaactggcttctattagatccatctttgatgaaaagtgcgtcgagtaccagaagcttctaatggatgaaaggcagaaggtagaggattcaatgcgactattgaaaattcaaaaggggttaacgcaatcacaagctaatcaactggttttcagatccgccacagatgaatttttggggaaagaaaaccaggcttctaaaaaacttttggaagttttaaaggcagaattgaaggatgtgaagaacagagaactgtgtgcttgtggtcaagtctcaggagcaacaaacaaacgcaaaagagagaagaacgagaaagaggaggaagctaacaatgaacagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

179

Amino Acids

20.77

Weight (kDa)

5.34

Isoelectric Point (pI)

44.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 357
AclWI GGATC 4 cut(s) 51, 64, 213, 348
AcsI RAATTY 2 cut(s) 306, 368
AdeI CACNNNGTG 1 cut(s) 114
AfaI GTAC 1 cut(s) 248
AfiI CCNNNNNNNGG 1 cut(s) 67
AgsI TTSAA 7 cut(s) 34, 41, 179, 291, 304, 311, 430
AjnI CCWGG 2 cut(s) 60, 387
AluBI AGCT 4 cut(s) 124, 256, 335, 524
AluI AGCT 4 cut(s) 124, 256, 335, 524
Alw21I GWGCWC 1 cut(s) 110
Alw26I GTCTC 1 cut(s) 475
Alw44I GTGCAC 1 cut(s) 106
AlwI GGATC 4 cut(s) 51, 64, 213, 348
ApaLI GTGCAC 1 cut(s) 106
ApoI RAATTY 2 cut(s) 306, 368
BaeGI GKGCMC 1 cut(s) 110
BamHI GGATCC 1 cut(s) 56
Bbv12I GWGCWC 1 cut(s) 110
BccI CCATC 1 cut(s) 230
BciT130I CCWGG 2 cut(s) 62, 389
BcoDI GTCTC 1 cut(s) 475
BglII AGATCT 1 cut(s) 86
Bme1390I CCNGG 2 cut(s) 62, 389
BmiI GGNNCC 1 cut(s) 58
BmrFI CCNGG 2 cut(s) 62, 389
Bpu10I CCTNAGC 1 cut(s) 66
BsaJI CCNNGG 1 cut(s) 60
Bsc4I CCNNNNNNNGG 1 cut(s) 67
Bse1I ACTGG 3 cut(s) 78, 210, 348
BseBI CCWGG 2 cut(s) 62, 389
BseDI CCNNGG 1 cut(s) 60
BseGI GGATG 3 cut(s) 10, 271, 439
BseLI CCNNNNNNNGG 1 cut(s) 67
BseMII CTCAG 1 cut(s) 486
BseNI ACTGG 3 cut(s) 78, 210, 348
BseRI GAGGAG 2 cut(s) 38, 530
BseSI GKGCMC 1 cut(s) 110
BsiHKAI GWGCWC 1 cut(s) 110
BslI CCNNNNNNNGG 1 cut(s) 67
BsmAI GTCTC 1 cut(s) 475
Bsp1286I GDGCHC 1 cut(s) 110
Bsp143I GATC 4 cut(s) 56, 86, 218, 353
BspACI CCGC 1 cut(s) 357
BspCNI CTCAG 1 cut(s) 485
BspLI GGNNCC 1 cut(s) 58
BspPI GGATC 4 cut(s) 51, 64, 213, 348
BsrI ACTGG 3 cut(s) 78, 210, 348
BssECI CCNNGG 1 cut(s) 60
BssMI GATC 4 cut(s) 56, 86, 218, 353
Bst2UI CCWGG 2 cut(s) 62, 389
Bst4CI ACNGT 2 cut(s) 453, 537
Bst6I CTCTTC 1 cut(s) 129
BstDEI CTNAG 4 cut(s) 66, 83, 128, 472
BstF5I GGATG 3 cut(s) 10, 271, 439
BstKTI GATC 4 cut(s) 59, 89, 221, 356
BstMAI GTCTC 1 cut(s) 475
BstMBI GATC 4 cut(s) 56, 86, 218, 353
BstNI CCWGG 2 cut(s) 62, 389
BstSCI CCNGG 2 cut(s) 60, 387
BstSLI GKGCMC 1 cut(s) 110
BstX2I RGATCY 4 cut(s) 56, 86, 218, 353
BstYI RGATCY 4 cut(s) 56, 86, 218, 353
BtsCI GGATG 3 cut(s) 10, 271, 439
CseI GACGC 1 cut(s) 229
Csp6I GTAC 1 cut(s) 247
CviJI RGCY 9 cut(s) 65, 77, 124, 197, 209, 256, 335, 392, 524
CviKI_1 RGCY 9 cut(s) 65, 77, 124, 197, 209, 256, 335, 392, 524
CviQI GTAC 1 cut(s) 247
DdeI CTNAG 4 cut(s) 66, 83, 128, 472
DpnI GATC 4 cut(s) 58, 88, 220, 355
DpnII GATC 4 cut(s) 56, 86, 218, 353
DraI TTTAAA 1 cut(s) 417
DraIII CACNNNGTG 1 cut(s) 114
Eam1104I CTCTTC 1 cut(s) 129
EarI CTCTTC 1 cut(s) 129
EciI GGCGGA 1 cut(s) 346
EcoRII CCWGG 2 cut(s) 60, 387
FokI GGATG 3 cut(s) 17, 278, 446
HgaI GACGC 1 cut(s) 229
HincII GTYRAC 1 cut(s) 321
HindII GTYRAC 1 cut(s) 321
HindIII AAGCTT 1 cut(s) 254
HinfI GANTC 2 cut(s) 26, 287
HpaI GTTAAC 1 cut(s) 321
Hpy166II GTNNAC 2 cut(s) 108, 321
Hpy188I TCNGA 1 cut(s) 353
Hpy188III TCNNGA 1 cut(s) 474
Hpy8I GTNNAC 2 cut(s) 108, 321
Hpy99I CGWCG 1 cut(s) 245
HpyAV CCTTC 5 cut(s) 10, 133, 139, 271, 424
HpyCH4III ACNGT 2 cut(s) 453, 537
HpyCH4V TGCA 1 cut(s) 108
HpyF3I CTNAG 4 cut(s) 66, 83, 128, 472
KspAI GTTAAC 1 cut(s) 321
Kzo9I GATC 4 cut(s) 56, 86, 218, 353
LmnI GCTCC 2 cut(s) 121, 476
MalI GATC 4 cut(s) 58, 88, 220, 355
MboI GATC 4 cut(s) 56, 86, 218, 353
MboII GAAGA 3 cut(s) 146, 451, 514
MflI RGATCY 4 cut(s) 56, 86, 218, 353
MhlI GDGCHC 1 cut(s) 110
MluCI AATT 5 cut(s) 36, 174, 306, 368, 425
MlyI GAGTC 1 cut(s) 35
MnlI CCTC 4 cut(s) 16, 277, 508, 511
MseI TTAA 4 cut(s) 95, 158, 320, 416
MspR9I CCNGG 2 cut(s) 62, 389
MvaI CCWGG 2 cut(s) 62, 389
NdeII GATC 4 cut(s) 56, 86, 218, 353
NlaIV GGNNCC 1 cut(s) 58
PfeI GAWTC 1 cut(s) 287
PleI GAGTC 1 cut(s) 34
PpsI GAGTC 1 cut(s) 34
Psp6I CCWGG 2 cut(s) 60, 387
PspGI CCWGG 2 cut(s) 60, 387
PspN4I GGNNCC 1 cut(s) 58
PsuI RGATCY 4 cut(s) 56, 86, 218, 353
RsaI GTAC 1 cut(s) 248
RsaNI GTAC 1 cut(s) 247
SaqAI TTAA 4 cut(s) 95, 158, 320, 416
Sau3AI GATC 4 cut(s) 56, 86, 218, 353
SchI GAGTC 1 cut(s) 35
ScrFI CCNGG 2 cut(s) 62, 389
SduI GDGCHC 1 cut(s) 110
SetI ASST 5 cut(s) 126, 258, 282, 337, 526
Sse9I AATT 5 cut(s) 36, 174, 306, 368, 425
SsiI CCGC 1 cut(s) 357
StyD4I CCNGG 2 cut(s) 60, 387
TaaI ACNGT 2 cut(s) 453, 537
TaqI TCGA 1 cut(s) 243
TasI AATT 5 cut(s) 36, 174, 306, 368, 425
TfiI GAWTC 1 cut(s) 287
Tru1I TTAA 4 cut(s) 95, 158, 320, 416
Tru9I TTAA 4 cut(s) 95, 158, 320, 416
TspDTI ATGAA 5 cut(s) 114, 216, 246, 282, 381
VneI GTGCAC 1 cut(s) 106
XapI RAATTY 2 cut(s) 306, 368
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.