RchiOBHm_Chr2g0094571

12-oxophytodienoate reductase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
7526345 .. 7527448
1104 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ46957

Sequence Viewer

Length: 213 bp
ATGAGTATGGAAACTGTGGCATTCGGTGATGCTGATTTACTGTCGTATGGTCGGGATTTTATCTCGAATCTTGACTTGGTGTTGAGGTTTAAGCTGAATGCTCCCTTGAACAAGTATATTAGGGAGACTTTCTACACTGATGTAGTTGGGTACACAGACTACCCTTTTCTGAACAGAGAAAATGTGAAAAAGGATGAGCACCCTTTGATTTGA

Protein Analysis

70

Amino Acids

8.19

Weight (kDa)

4.87

Isoelectric Point (pI)

22.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 152
AgsI TTSAA 1 cut(s) 109
AjuI GAANNNNNNNTTGG 2 cut(s) 59, 91
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
Alw21I GWGCWC 1 cut(s) 201
Alw26I GTCTC 1 cut(s) 119
AsuHPI GGTGA 1 cut(s) 38
Bbv12I GWGCWC 1 cut(s) 201
BcoDI GTCTC 1 cut(s) 119
BmsI GCATC 1 cut(s) 19
BseGI GGATG 1 cut(s) 199
BsiHKAI GWGCWC 1 cut(s) 201
BsmAI GTCTC 1 cut(s) 119
BsmI GAATGC 2 cut(s) 20, 103
Bsp1286I GDGCHC 1 cut(s) 201
Bst4CI ACNGT 2 cut(s) 16, 42
BstF5I GGATG 1 cut(s) 199
BstMAI GTCTC 1 cut(s) 119
BtsCI GGATG 1 cut(s) 199
BtsIMutI CAGTG 1 cut(s) 135
Csp6I GTAC 1 cut(s) 151
CviJI RGCY 1 cut(s) 94
CviKI_1 RGCY 1 cut(s) 94
CviQI GTAC 1 cut(s) 151
FaiI YATR 3 cut(s) 8, 48, 117
FokI GGATG 1 cut(s) 206
HinfI GANTC 1 cut(s) 67
HphI GGTGA 1 cut(s) 38
Hpy166II GTNNAC 1 cut(s) 153
Hpy188I TCNGA 1 cut(s) 171
Hpy188III TCNNGA 3 cut(s) 53, 64, 71
Hpy8I GTNNAC 1 cut(s) 153
HpyCH4III ACNGT 2 cut(s) 16, 42
LmnI GCTCC 1 cut(s) 106
LweI GCATC 1 cut(s) 19
MhlI GDGCHC 1 cut(s) 201
MnlI CCTC 1 cut(s) 78
MseI TTAA 1 cut(s) 90
Mva1269I GAATGC 2 cut(s) 20, 103
PctI GAATGC 2 cut(s) 20, 103
PfeI GAWTC 1 cut(s) 67
RsaI GTAC 1 cut(s) 152
RsaNI GTAC 1 cut(s) 151
SaqAI TTAA 1 cut(s) 90
SduI GDGCHC 1 cut(s) 201
SetI ASST 2 cut(s) 89, 96
SfaNI GCATC 1 cut(s) 19
SgeI CNNG 6 cut(s) 65, 76, 83, 88, 118, 124
TaaI ACNGT 2 cut(s) 16, 42
TaqI TCGA 1 cut(s) 65
TfiI GAWTC 1 cut(s) 67
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TscAI CASTG 1 cut(s) 142
TspRI CASTG 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.