Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007103.1

Orthogroup ID

OG0001555

Physical Location & Seq

Genomic Coordinates Reverse (-)

111333 .. 111791

Gene Structure 459 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007103.1_g000019.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 357 bp

atgaatagcagctgcagaactcgagaagaaagccttctgtatgtcaacaccaaaagcttcagaatggggctgaacaatatgcaatactcggtgagacttagaatttatcaccaacgaaaggcttttaatggtaccttcattgctgctggtggttttgacagggaagatgggaacaatgctgtggctgagggccgtgcagatcttattgcttttggtcgttggttcttggctaacccagatttgccaaagagatttgagtttaatgctcctctaaataagtacgacagagatacattctacatatctgatccggttcttggttacactgattatccatttcttgacagcactgcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0006950 GO:0008150 GO:0008152 GO:0009611 GO:0016491 GO:0016627 GO:0016628 GO:0016629 GO:0044464 GO:0050896 GO:0055114

KEGG Pathways

Metabolic & Signaling

ko00592 ko01100 ko01110 map00592 map01100 map01110

Pfam Domains

Protein Families

Oxidored_FMN

Protein Analysis

118

Amino Acids

13.61

Weight (kDa)

7.84

Isoelectric Point (pI)

40.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001555)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G17990 AT1G17990 AT1G18020
fragaria_vesca	FvH4_5g32750
malus_domestica	MD08G1216100.v1.1 MD08G1216200.v1.1 MD15G1401200.v1.1 MD15G1401300.v1.1 MD15G1401800.v1.1 MD15G1402400.v1.1 MD15G1402700.v1.1
prunus_persica	Prupe.1G465800_v2.0.a1 Prupe.1G548300_v2.0.a1 Prupe.1G548400_v2.0.a1 Prupe.1G548600_v2.0.a1 Prupe.1G548700_v2.0.a1 Prupe.1G548800_v2.0.a1 Prupe.1G548900_v2.0.a1 Prupe.1G549000_v2.0.a1 Prupe.7G200600_v2.0.a1
pyrus_communis	pycom08g18710 pycom08g18720 pycom15g35950 pycom15g35960 pycom15g35970 pycom15g36010 pycom15g36020
rosa_chinensis	RchiOBHm_Chr2g0094571 RchiOBHm_Chr2g0094601 RchiOBHm_Chr2g0167371 RchiOBHm_Chr7g0230371 RchiOBHm_Chr7g0230381 RchiOBHm_Chr7g0230411 RchiOBHm_Chr7g0230421
rosa_laevigata	RLG00000001497 RLG00000009949 RLG00000016505 RLG00000021711
rosa_multiflora	Rmu_co8113900.1_g000001 Rmu_sc0001840.1_g000007 Rmu_sc0002541.1_g000033 Rmu_sc0007103.1_g000019
rosa_roxburghii	Rroxscaffold_2G00083570
rosa_rugosa	Rorug02G0045500 Rorug02G0529800 Rorug07G0260300
rosa_samantha	Rh2BG093600 Rh2BG608200
rosa_wichuraiana	Rw2G049670 Rw7G034200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	131
AccB1I	GGYRCC	1 cut(s)	131
AclWI	GGATC	1 cut(s)	302
AcsI	RAATTY	1 cut(s)	102
AcuI	CTGAAG	1 cut(s)	43
AfaI	GTAC	2 cut(s)	133, 281
AfiI	CCNNNNNNNGG	2 cut(s)	118, 317
AluBI	AGCT	2 cut(s)	12, 57
AluI	AGCT	2 cut(s)	12, 57
Alw26I	GTCTC	1 cut(s)	88
AlwI	GGATC	1 cut(s)	302
Ama87I	CYCGRG	1 cut(s)	21
AoxI	GGCC	1 cut(s)	190
ApeKI	GCWGC	3 cut(s)	9, 12, 143
ApoI	RAATTY	1 cut(s)	102
Asp700I	GAANNNNTTC	1 cut(s)	33
Asp718I	GGTACC	1 cut(s)	131
AspS9I	GGNCC	1 cut(s)	190
AsuHPI	GGTGA	2 cut(s)	101, 103
AvaI	CYCGRG	1 cut(s)	21
BanI	GGYRCC	1 cut(s)	131
BbvCI	CCTCAGC	1 cut(s)	186
BbvI	GCAGC	2 cut(s)	21, 130
BccI	CCATC	1 cut(s)	161
BceAI	ACGGC	1 cut(s)	177
BcoDI	GTCTC	1 cut(s)	88
BfmI	CTRYAG	1 cut(s)	13
BglII	AGATCT	1 cut(s)	199
BisI	GCNGC	3 cut(s)	10, 13, 144
BlsI	GCNGC	3 cut(s)	11, 14, 145
BmeT110I	CYCGRG	1 cut(s)	21
BmgT120I	GGNCC	1 cut(s)	190
BmiI	GGNNCC	1 cut(s)	133
Bpu10I	CCTNAGC	1 cut(s)	186
BsaWI	WCCGGW	1 cut(s)	310
Bsc4I	CCNNNNNNNGG	2 cut(s)	118, 317
Bse3DI	GCAATG	1 cut(s)	138
BseLI	CCNNNNNNNGG	2 cut(s)	118, 317
BseMI	GCAATG	1 cut(s)	138
BseMII	CTCAG	1 cut(s)	177
BseRI	GAGGAG	1 cut(s)	258
BseXI	GCAGC	2 cut(s)	21, 130
BsgI	GTGCAG	1 cut(s)	216
BshFI	GGCC	1 cut(s)	192
BshNI	GGYRCC	1 cut(s)	131
BsiHKCI	CYCGRG	1 cut(s)	21
BsiSI	CCGG	1 cut(s)	311
BslI	CCNNNNNNNGG	2 cut(s)	118, 317
BsmAI	GTCTC	1 cut(s)	88
BsnI	GGCC	1 cut(s)	192
BsoBI	CYCGRG	1 cut(s)	21
Bsp143I	GATC	2 cut(s)	199, 307
BspANI	GGCC	1 cut(s)	192
BspCNI	CTCAG	1 cut(s)	178
BspLI	GGNNCC	1 cut(s)	133
BspMAI	CTGCAG	1 cut(s)	17
BspPI	GGATC	1 cut(s)	302
BspT107I	GGYRCC	1 cut(s)	131
BsrDI	GCAATG	1 cut(s)	138
BssMI	GATC	2 cut(s)	199, 307
BstDEI	CTNAG	2 cut(s)	98, 186
BstKTI	GATC	2 cut(s)	202, 310
BstMAI	GTCTC	1 cut(s)	88
BstMBI	GATC	2 cut(s)	199, 307
BstSFI	CTRYAG	1 cut(s)	13
BstV1I	GCAGC	2 cut(s)	21, 130
BstX2I	RGATCY	1 cut(s)	199
BstYI	RGATCY	1 cut(s)	199
BsuRI	GGCC	1 cut(s)	192
BtsI	GCAGTG	1 cut(s)	348
BtsIMutI	CAGTG	2 cut(s)	324, 348
Cfr13I	GGNCC	1 cut(s)	190
Csp6I	GTAC	2 cut(s)	132, 280
CviJI	RGCY	8 cut(s)	12, 33, 57, 70, 122, 185, 192, 230
CviKI_1	RGCY	8 cut(s)	12, 33, 57, 70, 122, 185, 192, 230
CviQI	GTAC	2 cut(s)	132, 280
DdeI	CTNAG	2 cut(s)	98, 186
DpnI	GATC	2 cut(s)	201, 309
DpnII	GATC	2 cut(s)	199, 307
Eco57I	CTGAAG	1 cut(s)	43
Eco88I	CYCGRG	1 cut(s)	21
FaiI	YATR	3 cut(s)	42, 80, 302
FalI	AAGNNNNNCTT	2 cut(s)	18, 50
Fnu4HI	GCNGC	3 cut(s)	10, 13, 144
Fsp4HI	GCNGC	3 cut(s)	10, 13, 144
GluI	GCNGC	3 cut(s)	10, 13, 144
HaeIII	GGCC	1 cut(s)	192
HapII	CCGG	1 cut(s)	311
HincII	GTYRAC	1 cut(s)	46
HindII	GTYRAC	1 cut(s)	46
HindIII	AAGCTT	1 cut(s)	55
HpaII	CCGG	1 cut(s)	311
HphI	GGTGA	2 cut(s)	101, 103
Hpy166II	GTNNAC	1 cut(s)	46
Hpy188I	TCNGA	2 cut(s)	62, 307
Hpy188III	TCNNGA	2 cut(s)	23, 341
Hpy8I	GTNNAC	1 cut(s)	46
HpyAV	CCTTC	2 cut(s)	44, 145
HpyCH4V	TGCA	3 cut(s)	15, 82, 197
HpyF3I	CTNAG	2 cut(s)	98, 186
KpnI	GGTACC	1 cut(s)	135
Kzo9I	GATC	2 cut(s)	199, 307
LmnI	GCTCC	1 cut(s)	271
LpnPI	CCDG	4 cut(s)	132, 145, 249, 324
Lsp1109I	GCAGC	2 cut(s)	21, 130
MaeIII	GTNAC	1 cut(s)	320
MalI	GATC	2 cut(s)	201, 309
MboI	GATC	2 cut(s)	199, 307
MboII	GAAGA	2 cut(s)	38, 176
MflI	RGATCY	1 cut(s)	199
MluCI	AATT	1 cut(s)	102
MnlI	CCTC	2 cut(s)	181, 279
MroXI	GAANNNNTTC	1 cut(s)	33
MseI	TTAA	2 cut(s)	126, 261
MspA1I	CMGCKG	1 cut(s)	12
MspI	CCGG	1 cut(s)	311
NdeII	GATC	2 cut(s)	199, 307
NlaIV	GGNNCC	1 cut(s)	133
PaeR7I	CTCGAG	1 cut(s)	21
PdmI	GAANNNNTTC	1 cut(s)	33
PkrI	GCNGC	3 cut(s)	11, 14, 145
PspN4I	GGNNCC	1 cut(s)	133
PspPI	GGNCC	1 cut(s)	190
PstI	CTGCAG	1 cut(s)	17
PsuI	RGATCY	1 cut(s)	199
PvuII	CAGCTG	1 cut(s)	12
RsaI	GTAC	2 cut(s)	133, 281
RsaNI	GTAC	2 cut(s)	132, 280
SaqAI	TTAA	2 cut(s)	126, 261
SatI	GCNGC	3 cut(s)	10, 13, 144
Sau3AI	GATC	2 cut(s)	199, 307
Sau96I	GGNCC	1 cut(s)	190
SetI	ASST	3 cut(s)	14, 59, 137
SfcI	CTRYAG	1 cut(s)	13
Sfr274I	CTCGAG	1 cut(s)	21
SlaI	CTCGAG	1 cut(s)	21
SmlI	CTYRAG	1 cut(s)	21
SmoI	CTYRAG	1 cut(s)	21
Sse9I	AATT	1 cut(s)	102
TaqI	TCGA	1 cut(s)	22
TasI	AATT	1 cut(s)	102
Tru1I	TTAA	2 cut(s)	126, 261
Tru9I	TTAA	2 cut(s)	126, 261
TscAI	CASTG	2 cut(s)	331, 355
TseI	GCWGC	3 cut(s)	9, 12, 143
TspDTI	ATGAA	2 cut(s)	17, 127
TspRI	CASTG	2 cut(s)	331, 355
XapI	RAATTY	1 cut(s)	102
XhoI	CTCGAG	1 cut(s)	21
XmnI	GAANNNNTTC	1 cut(s)	33

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.