RchiOBHm_Chr3g0460251

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0001212
Physical Location & Seq
Forward (+)
8432020 .. 8432406
387 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ42678

Sequence Viewer

Length: 204 bp
ATGCTCACATATGATTCTGCTCAAAGAATCACAGCGCGAAAAGTAATGGAGCATCCCTATTTCAACCAAGATGGCTTTGAGATCGAGGTGGCAGTTCTGAAGATTTTGTGGGAATGTAATTGGGATACTGGGTTATCCTTGGTTCCTAGTCACTTGGAAATAGTTAGTAGTGTTACTGAAATGGAGATGGTTAATACAGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.67

Weight (kDa)

4.52

Isoelectric Point (pI)

39.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 37
AcuI CTGAAG 1 cut(s) 119
AgsI TTSAA 1 cut(s) 64
AspLEI GCGC 1 cut(s) 37
BccI CCATC 2 cut(s) 65, 181
BciVI GTATCC 1 cut(s) 118
BfaI CTAG 1 cut(s) 147
BfuI GTATCC 1 cut(s) 118
BmiI GGNNCC 1 cut(s) 144
BmrI ACTGGG 1 cut(s) 138
BmsI GCATC 1 cut(s) 61
BmuI ACTGGG 1 cut(s) 138
BsaJI CCNNGG 1 cut(s) 138
Bse1I ACTGG 1 cut(s) 133
BseDI CCNNGG 1 cut(s) 138
BseGI GGATG 1 cut(s) 52
BseNI ACTGG 1 cut(s) 133
Bsh1236I CGCG 1 cut(s) 37
Bsp143I GATC 1 cut(s) 81
BspFNI CGCG 1 cut(s) 37
BspLI GGNNCC 1 cut(s) 144
BsrI ACTGG 1 cut(s) 133
BssECI CCNNGG 1 cut(s) 138
BssMI GATC 1 cut(s) 81
BssT1I CCWWGG 1 cut(s) 138
BstF5I GGATG 1 cut(s) 52
BstFNI CGCG 1 cut(s) 37
BstHHI GCGC 1 cut(s) 37
BstKTI GATC 1 cut(s) 84
BstMBI GATC 1 cut(s) 81
BstUI CGCG 1 cut(s) 37
BsuI GTATCC 1 cut(s) 118
BtsCI GGATG 1 cut(s) 52
CfoI GCGC 1 cut(s) 37
CviJI RGCY 1 cut(s) 75
CviKI_1 RGCY 1 cut(s) 75
DpnI GATC 1 cut(s) 83
DpnII GATC 1 cut(s) 81
Eco130I CCWWGG 1 cut(s) 138
Eco57I CTGAAG 1 cut(s) 119
EcoT14I CCWWGG 1 cut(s) 138
ErhI CCWWGG 1 cut(s) 138
FaiI YATR 2 cut(s) 10, 12
FauNDI CATATG 1 cut(s) 10
FokI GGATG 1 cut(s) 39
FspBI CTAG 1 cut(s) 147
GlaI GCGC 1 cut(s) 36
HhaI GCGC 1 cut(s) 37
Hin6I GCGC 1 cut(s) 35
HinP1I GCGC 1 cut(s) 35
HinfI GANTC 2 cut(s) 14, 27
Hpy188I TCNGA 1 cut(s) 99
HspAI GCGC 1 cut(s) 35
Kzo9I GATC 1 cut(s) 81
LmnI GCTCC 1 cut(s) 49
LpnPI CCDG 2 cut(s) 114, 183
LweI GCATC 1 cut(s) 61
MaeI CTAG 1 cut(s) 147
MaeIII GTNAC 2 cut(s) 149, 172
MalI GATC 1 cut(s) 83
MboI GATC 1 cut(s) 81
MboII GAAGA 1 cut(s) 112
MluCI AATT 1 cut(s) 118
MnlI CCTC 1 cut(s) 79
MseI TTAA 1 cut(s) 192
MvnI CGCG 1 cut(s) 37
NdeI CATATG 1 cut(s) 10
NdeII GATC 1 cut(s) 81
NlaIV GGNNCC 1 cut(s) 144
NmuCI GTSAC 1 cut(s) 149
PfeI GAWTC 2 cut(s) 14, 27
PspN4I GGNNCC 1 cut(s) 144
SaqAI TTAA 1 cut(s) 192
Sau3AI GATC 1 cut(s) 81
SetI ASST 1 cut(s) 90
SfaNI GCATC 1 cut(s) 61
SgeI CNNG 7 cut(s) 48, 80, 97, 141, 151, 159, 166
Sse9I AATT 1 cut(s) 118
SspMI CTAG 1 cut(s) 147
StyI CCWWGG 1 cut(s) 138
TaqI TCGA 1 cut(s) 84
TasI AATT 1 cut(s) 118
TfiI GAWTC 2 cut(s) 14, 27
Tru1I TTAA 1 cut(s) 192
Tru9I TTAA 1 cut(s) 192
TseFI GTSAC 1 cut(s) 149
Tsp45I GTSAC 1 cut(s) 149
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.