RchiOBHm_Chr3g0465601

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
12336333 .. 12336923
591 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ43174

Sequence Viewer

Length: 507 bp
ATGTTTCTGCCTCTCGAAAGAGAGCTTTCTCCTCCGCTTCCTCTCTACGCTGGTGGAGGCAGTGTACTTTCGATCTGGAAGGATGGCTTTGCCTCCTTCTATGGTCCATACTGTGGTGGTGGAGACGGGCTCCTCCATGGAAATCTGCCCAAATCTCTCTCTCAAGCTTCTGATGGCAGAAGTGAGGGTGATTTGGTGTTTGATCGGGTCTACAGTGGTGTGCTCGTGGGTGAAACGACTTGTGGCGCTTGGAGAGCTGATGGATCTGATCGGATCTGGAATTTGGCTTACAAGAGGCTGAGCTTGCCGGCTGATGGTAGCGCTCTCTGGCATGGCTGGGATCGATCGTTTTTGTTGGAGGACAACGGGATCAGTGGTGCTCTCGATTCTTCTTTACTAGCAGAGGTGGATGACGGGCTGGCATTGGGCGTCGAGAGGATGCTATCAGTGATGGTGGTCGTGCAGGGGTCAAACTCCGGTGAGTGGTGTATGATGGCGGCGGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

168

Amino Acids

17.85

Weight (kDa)

4.43

Isoelectric Point (pI)

35.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 113
AccI GTMKAC 1 cut(s) 210
AciI CCGC 3 cut(s) 35, 497, 500
AclWI GGATC 4 cut(s) 271, 281, 348, 377
AcsI RAATTY 1 cut(s) 280
AcyI GRCGYC 1 cut(s) 429
AfaI GTAC 1 cut(s) 66
AfeI AGCGCT 1 cut(s) 322
AfiI CCNNNNNNNGG 3 cut(s) 113, 314, 483
AluBI AGCT 4 cut(s) 25, 167, 257, 303
AluI AGCT 4 cut(s) 25, 167, 257, 303
Alw21I GWGCWC 2 cut(s) 225, 382
Alw26I GTCTC 1 cut(s) 117
AlwI GGATC 4 cut(s) 271, 281, 348, 377
Aor51HI AGCGCT 1 cut(s) 322
ApoI RAATTY 1 cut(s) 280
AspLEI GCGC 2 cut(s) 248, 323
AspS9I GGNCC 1 cut(s) 104
AsuHPI GGTGA 3 cut(s) 200, 242, 491
AvaII GGWCC 1 cut(s) 104
BanII GRGCYC 1 cut(s) 132
BauI CACGAG 1 cut(s) 224
Bbv12I GWGCWC 2 cut(s) 225, 382
BccI CCATC 6 cut(s) 77, 167, 254, 308, 445, 487
BcoDI GTCTC 1 cut(s) 117
BfaI CTAG 1 cut(s) 398
BfmI CTRYAG 1 cut(s) 211
BfoI RGCGCY 2 cut(s) 249, 324
BisI GCNGC 2 cut(s) 498, 501
BlpI GCTNAGC 1 cut(s) 299
BlsI GCNGC 2 cut(s) 499, 502
Bme18I GGWCC 1 cut(s) 104
BmgT120I GGNCC 1 cut(s) 104
BmiI GGNNCC 1 cut(s) 131
BmsI GCATC 1 cut(s) 429
BplI GAGNNNNNCTC 2 cut(s) 114, 146
Bpu1102I GCTNAGC 1 cut(s) 299
BpuEI CTTGAG 1 cut(s) 147
Bsa29I ATCGAT 1 cut(s) 343
BsaHI GRCGYC 1 cut(s) 429
BsaJI CCNNGG 1 cut(s) 136
BsaWI WCCGGW 1 cut(s) 476
BsaXI ACNNNNNCTCC 2 cut(s) 48, 78
Bsc4I CCNNNNNNNGG 3 cut(s) 113, 314, 483
Bse118I RCCGGY 1 cut(s) 307
BseCI ATCGAT 1 cut(s) 343
BseDI CCNNGG 1 cut(s) 136
BseGI GGATG 3 cut(s) 88, 415, 444
BseLI CCNNNNNNNGG 3 cut(s) 113, 314, 483
BseMII CTCAG 1 cut(s) 290
BseRI GAGGAG 2 cut(s) 21, 122
BseYI CCCAGC 1 cut(s) 336
BsgI GTGCAG 1 cut(s) 482
Bsh1285I CGRYCG 1 cut(s) 347
BshVI ATCGAT 1 cut(s) 343
BsiEI CGRYCG 1 cut(s) 347
BsiHKAI GWGCWC 2 cut(s) 225, 382
BsiSI CCGG 2 cut(s) 308, 477
BslI CCNNNNNNNGG 3 cut(s) 113, 314, 483
BsmAI GTCTC 1 cut(s) 117
BsmBI CGTCTC 1 cut(s) 117
Bsp1286I GDGCHC 3 cut(s) 132, 225, 382
Bsp143I GATC 8 cut(s) 72, 202, 263, 268, 273, 340, 344, 369
Bsp1720I GCTNAGC 1 cut(s) 299
Bsp19I CCATGG 1 cut(s) 136
BspACI CCGC 3 cut(s) 35, 497, 500
BspCNI CTCAG 1 cut(s) 291
BspDI ATCGAT 1 cut(s) 343
BspLI GGNNCC 1 cut(s) 131
BspPI GGATC 4 cut(s) 271, 281, 348, 377
BsrFI RCCGGY 1 cut(s) 307
BssAI RCCGGY 1 cut(s) 307
BssECI CCNNGG 1 cut(s) 136
BssMI GATC 8 cut(s) 72, 202, 263, 268, 273, 340, 344, 369
BssNI GRCGYC 1 cut(s) 429
BssSI CACGAG 1 cut(s) 224
BssT1I CCWWGG 1 cut(s) 136
Bst2BI CACGAG 1 cut(s) 224
Bst4CI ACNGT 2 cut(s) 113, 215
BstACI GRCGYC 1 cut(s) 429
BstC8I GCNNGC 3 cut(s) 305, 309, 420
BstDEI CTNAG 1 cut(s) 299
BstDSI CCRYGG 1 cut(s) 136
BstF5I GGATG 3 cut(s) 88, 415, 444
BstH2I RGCGCY 2 cut(s) 249, 324
BstHHI GCGC 2 cut(s) 248, 323
BstKTI GATC 8 cut(s) 75, 205, 266, 271, 276, 343, 347, 372
BstMAI GTCTC 1 cut(s) 117
BstMBI GATC 8 cut(s) 72, 202, 263, 268, 273, 340, 344, 369
BstMCI CGRYCG 1 cut(s) 347
BstMWI GCNNNNNNNGC 2 cut(s) 254, 304
BstSFI CTRYAG 1 cut(s) 211
BstX2I RGATCY 2 cut(s) 263, 273
BstYI RGATCY 2 cut(s) 263, 273
Bsu15I ATCGAT 1 cut(s) 343
BsuTUI ATCGAT 1 cut(s) 343
BtgI CCRYGG 1 cut(s) 136
BtsCI GGATG 3 cut(s) 88, 415, 444
BtsI GCAGTG 1 cut(s) 67
BtsIMutI CAGTG 4 cut(s) 67, 220, 379, 453
Cac8I GCNNGC 3 cut(s) 305, 309, 420
CfoI GCGC 2 cut(s) 248, 323
Cfr10I RCCGGY 1 cut(s) 307
Cfr13I GGNCC 1 cut(s) 104
ClaI ATCGAT 1 cut(s) 343
CseI GACGC 1 cut(s) 418
Csp6I GTAC 1 cut(s) 65
CviAII CATG 2 cut(s) 137, 332
CviQI GTAC 1 cut(s) 65
DdeI CTNAG 1 cut(s) 299
DpnI GATC 8 cut(s) 74, 204, 265, 270, 275, 342, 346, 371
DpnII GATC 8 cut(s) 72, 202, 263, 268, 273, 340, 344, 369
Eco130I CCWWGG 1 cut(s) 136
Eco24I GRGCYC 1 cut(s) 132
Eco47I GGWCC 1 cut(s) 104
Eco47III AGCGCT 1 cut(s) 322
EcoT14I CCWWGG 1 cut(s) 136
EcoT38I GRGCYC 1 cut(s) 132
ErhI CCWWGG 1 cut(s) 136
Esp3I CGTCTC 1 cut(s) 117
FaeI CATG 2 cut(s) 140, 335
FaiI YATR 5 cut(s) 102, 109, 138, 333, 491
FalI AAGNNNNNCTT 2 cut(s) 71, 103
FatI CATG 2 cut(s) 136, 331
FblI GTMKAC 1 cut(s) 210
Fnu4HI GCNGC 2 cut(s) 498, 501
FokI GGATG 3 cut(s) 95, 422, 451
FriOI GRGCYC 1 cut(s) 132
Fsp4HI GCNGC 2 cut(s) 498, 501
FspBI CTAG 1 cut(s) 398
GlaI GCGC 2 cut(s) 247, 322
GluI GCNGC 2 cut(s) 498, 501
GsaI CCCAGC 1 cut(s) 340
HaeII RGCGCY 2 cut(s) 249, 324
HapII CCGG 2 cut(s) 308, 477
HgaI GACGC 1 cut(s) 418
HhaI GCGC 2 cut(s) 248, 323
Hin1I GRCGYC 1 cut(s) 429
Hin1II CATG 2 cut(s) 140, 335
Hin6I GCGC 2 cut(s) 246, 321
HinP1I GCGC 2 cut(s) 246, 321
HindIII AAGCTT 1 cut(s) 165
HinfI GANTC 1 cut(s) 386
HpaII CCGG 2 cut(s) 308, 477
HphI GGTGA 3 cut(s) 200, 242, 491
Hpy166II GTNNAC 2 cut(s) 65, 211
Hpy188I TCNGA 3 cut(s) 172, 268, 273
Hpy188III TCNNGA 5 cut(s) 14, 76, 277, 383, 433
Hpy8I GTNNAC 2 cut(s) 65, 211
Hpy99I CGWCG 1 cut(s) 434
HpyAV CCTTC 2 cut(s) 73, 106
HpyCH4III ACNGT 2 cut(s) 113, 215
HpyCH4V TGCA 1 cut(s) 463
HpyF10VI GCNNNNNNNGC 2 cut(s) 254, 304
HpyF3I CTNAG 1 cut(s) 299
Hsp92I GRCGYC 1 cut(s) 429
Hsp92II CATG 2 cut(s) 140, 335
HspAI GCGC 2 cut(s) 246, 321
KroI GCCGGC 1 cut(s) 307
KroNI GCCGGC 1 cut(s) 309
Kzo9I GATC 8 cut(s) 72, 202, 263, 268, 273, 340, 344, 369
LmnI GCTCC 1 cut(s) 135
LpnPI CCDG 9 cut(s) 36, 61, 262, 313, 321, 322, 404, 449, 490
LweI GCATC 1 cut(s) 429
MaeI CTAG 1 cut(s) 398
MalI GATC 8 cut(s) 74, 204, 265, 270, 275, 342, 346, 371
MboI GATC 8 cut(s) 72, 202, 263, 268, 273, 340, 344, 369
MboII GAAGA 1 cut(s) 381
MflI RGATCY 2 cut(s) 263, 273
MhlI GDGCHC 3 cut(s) 132, 225, 382
MluCI AATT 1 cut(s) 280
MmeI TCCRAC 1 cut(s) 336
MroNI GCCGGC 1 cut(s) 307
MspI CCGG 2 cut(s) 308, 477
MwoI GCNNNNNNNGC 2 cut(s) 254, 304
NaeI GCCGGC 1 cut(s) 309
NcoI CCATGG 1 cut(s) 136
NdeII GATC 8 cut(s) 72, 202, 263, 268, 273, 340, 344, 369
NgoMIV GCCGGC 1 cut(s) 307
NlaIII CATG 2 cut(s) 140, 335
NlaIV GGNNCC 1 cut(s) 131
PdiI GCCGGC 1 cut(s) 309
PfeI GAWTC 1 cut(s) 386
PflMI CCANNNNNTGG 1 cut(s) 113
PkrI GCNGC 2 cut(s) 499, 502
Ple19I CGATCG 1 cut(s) 347
PspFI CCCAGC 1 cut(s) 336
PspN4I GGNNCC 1 cut(s) 131
PspPI GGNCC 1 cut(s) 104
PsuI RGATCY 2 cut(s) 263, 273
PvuI CGATCG 1 cut(s) 347
RsaI GTAC 1 cut(s) 66
RsaNI GTAC 1 cut(s) 65
SatI GCNGC 2 cut(s) 498, 501
Sau3AI GATC 8 cut(s) 72, 202, 263, 268, 273, 340, 344, 369
Sau96I GGNCC 1 cut(s) 104
SduI GDGCHC 3 cut(s) 132, 225, 382
SetI ASST 5 cut(s) 27, 169, 259, 305, 408
SfaNI GCATC 1 cut(s) 429
SfcI CTRYAG 1 cut(s) 211
SinI GGWCC 1 cut(s) 104
SmlI CTYRAG 1 cut(s) 162
SmoI CTYRAG 1 cut(s) 162
Sse9I AATT 1 cut(s) 280
SsiI CCGC 3 cut(s) 35, 497, 500
SspMI CTAG 1 cut(s) 398
StyI CCWWGG 1 cut(s) 136
TaaI ACNGT 2 cut(s) 113, 215
TaqI TCGA 5 cut(s) 15, 71, 343, 384, 432
TasI AATT 1 cut(s) 280
TatI WGTACW 1 cut(s) 64
TauI GCSGC 2 cut(s) 500, 503
TfiI GAWTC 1 cut(s) 386
TscAI CASTG 4 cut(s) 67, 220, 379, 453
TspRI CASTG 4 cut(s) 67, 220, 379, 453
Van91I CCANNNNNTGG 1 cut(s) 113
VpaK11BI GGWCC 1 cut(s) 104
XapI RAATTY 1 cut(s) 280
XmiI GTMKAC 1 cut(s) 210
XspI CTAG 1 cut(s) 398
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.