Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0016988.1

Orthogroup ID

OG0003073

Physical Location & Seq

Genomic Coordinates Forward (+)

217 .. 468

Gene Structure 252 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0016988.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 252 bp

atgtttctgcctctcaaaagagagctttctcctccacttcctctctacgctggtggaggctgtgtactttcgatctggaaggatggctttgcctccttctatggtccaaactgtggtggtggagacgggctcctccgtcgaaatctgcctaaatctctctctcaagcttctgatggcggaagtgagggtgatctggtgtttgatcggatctacagtggtgtgctcgtgggtgaaacgaatggtggtgcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

83

Amino Acids

8.62

Weight (kDa)

5.09

Isoelectric Point (pI)

50.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003073)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr0c29g0501151 RchiOBHm_Chr1g0314121 RchiOBHm_Chr3g0465601 RchiOBHm_Chr3g0471431 RchiOBHm_Chr4g0414901
rosa_laevigata	RLG00000009299 RLG00000019736 RLG00000034336
rosa_multiflora	Rmu_sc0008611.1_g000006 Rmu_sc0008990.1_g000005 Rmu_sc0016988.1_g000001
rosa_roxburghii	Rroxscaffold_2G00140650 Rroxscaffold_3G00232870 Rroxscaffold_4G00298360 Rroxscaffold_6G00410590 Rroxscaffold_7G00190580
rosa_rugosa	Rorug05G0514000 Rorug06G0152500
rosa_samantha	Rh1AG063100 Rh1CG057100 Rh1DG060900 Rh2AG300600 Rh2AG507500 Rh2AG675700 Rh2BG139500 Rh2BG251500 Rh2BG308300 Rh2DG324800 Rh3AG108200 Rh3BG141000 Rh3CG113900 Rh4AG220200 Rh5AG334300 Rh5AG484600 Rh5CG560700 Rh5DG220200 Rh6BG336400 Rh7AG393300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	113
AciI	CCGC	1 cut(s)	177
AclWI	GGATC	1 cut(s)	215
AfaI	GTAC	1 cut(s)	66
AfiI	CCNNNNNNNGG	1 cut(s)	113
AluBI	AGCT	2 cut(s)	25, 167
AluI	AGCT	2 cut(s)	25, 167
Alw21I	GWGCWC	1 cut(s)	225
Alw26I	GTCTC	1 cut(s)	117
AlwI	GGATC	1 cut(s)	215
AspS9I	GGNCC	1 cut(s)	104
AsuHPI	GGTGA	2 cut(s)	200, 242
AvaII	GGWCC	1 cut(s)	104
BanII	GRGCYC	1 cut(s)	132
BauI	CACGAG	1 cut(s)	224
Bbv12I	GWGCWC	1 cut(s)	225
BccI	CCATC	2 cut(s)	77, 167
BcoDI	GTCTC	1 cut(s)	117
BfmI	CTRYAG	1 cut(s)	211
Bme18I	GGWCC	1 cut(s)	104
BmgT120I	GGNCC	1 cut(s)	104
BmiI	GGNNCC	1 cut(s)	131
BplI	GAGNNNNNCTC	2 cut(s)	114, 146
BpuEI	CTTGAG	1 cut(s)	147
BsaXI	ACNNNNNCTCC	2 cut(s)	48, 78
Bsc4I	CCNNNNNNNGG	1 cut(s)	113
BseGI	GGATG	1 cut(s)	88
BseLI	CCNNNNNNNGG	1 cut(s)	113
BseRI	GAGGAG	2 cut(s)	21, 122
BsiHKAI	GWGCWC	1 cut(s)	225
BslI	CCNNNNNNNGG	1 cut(s)	113
BsmAI	GTCTC	1 cut(s)	117
BsmBI	CGTCTC	1 cut(s)	117
Bsp1286I	GDGCHC	2 cut(s)	132, 225
Bsp143I	GATC	4 cut(s)	72, 190, 202, 207
BspACI	CCGC	1 cut(s)	177
BspLI	GGNNCC	1 cut(s)	131
BspPI	GGATC	1 cut(s)	215
BssMI	GATC	4 cut(s)	72, 190, 202, 207
BssSI	CACGAG	1 cut(s)	224
Bst2BI	CACGAG	1 cut(s)	224
Bst4CI	ACNGT	2 cut(s)	113, 215
BstDEI	CTNAG	1 cut(s)	249
BstF5I	GGATG	1 cut(s)	88
BstKTI	GATC	4 cut(s)	75, 193, 205, 210
BstMAI	GTCTC	1 cut(s)	117
BstMBI	GATC	4 cut(s)	72, 190, 202, 207
BstSFI	CTRYAG	1 cut(s)	211
BstX2I	RGATCY	1 cut(s)	207
BstYI	RGATCY	1 cut(s)	207
BtsCI	GGATG	1 cut(s)	88
BtsIMutI	CAGTG	1 cut(s)	220
Cfr13I	GGNCC	1 cut(s)	104
Csp6I	GTAC	1 cut(s)	65
CviJI	RGCY	5 cut(s)	25, 60, 87, 130, 167
CviKI_1	RGCY	5 cut(s)	25, 60, 87, 130, 167
CviQI	GTAC	1 cut(s)	65
DdeI	CTNAG	1 cut(s)	249
DpnI	GATC	4 cut(s)	74, 192, 204, 209
DpnII	GATC	4 cut(s)	72, 190, 202, 207
EciI	GGCGGA	1 cut(s)	192
Eco24I	GRGCYC	1 cut(s)	132
Eco47I	GGWCC	1 cut(s)	104
EcoT38I	GRGCYC	1 cut(s)	132
Esp3I	CGTCTC	1 cut(s)	117
FaiI	YATR	1 cut(s)	102
FalI	AAGNNNNNCTT	2 cut(s)	71, 103
FokI	GGATG	1 cut(s)	95
FriOI	GRGCYC	1 cut(s)	132
HindIII	AAGCTT	1 cut(s)	165
HphI	GGTGA	2 cut(s)	200, 242
Hpy166II	GTNNAC	1 cut(s)	65
Hpy188I	TCNGA	2 cut(s)	172, 207
Hpy188III	TCNNGA	1 cut(s)	76
Hpy8I	GTNNAC	1 cut(s)	65
Hpy99I	CGWCG	1 cut(s)	141
HpyAV	CCTTC	2 cut(s)	73, 106
HpyCH4III	ACNGT	2 cut(s)	113, 215
HpyF3I	CTNAG	1 cut(s)	249
Kzo9I	GATC	4 cut(s)	72, 190, 202, 207
LmnI	GCTCC	1 cut(s)	135
LpnPI	CCDG	3 cut(s)	36, 61, 179
MalI	GATC	4 cut(s)	74, 192, 204, 209
MboI	GATC	4 cut(s)	72, 190, 202, 207
MflI	RGATCY	1 cut(s)	207
MhlI	GDGCHC	2 cut(s)	132, 225
MnlI	CCTC	7 cut(s)	21, 42, 50, 51, 103, 143, 178
NdeII	GATC	4 cut(s)	72, 190, 202, 207
NlaIV	GGNNCC	1 cut(s)	131
PflMI	CCANNNNNTGG	1 cut(s)	113
PspN4I	GGNNCC	1 cut(s)	131
PspPI	GGNCC	1 cut(s)	104
PsuI	RGATCY	1 cut(s)	207
RsaI	GTAC	1 cut(s)	66
RsaNI	GTAC	1 cut(s)	65
Sau3AI	GATC	4 cut(s)	72, 190, 202, 207
Sau96I	GGNCC	1 cut(s)	104
SduI	GDGCHC	2 cut(s)	132, 225
SetI	ASST	2 cut(s)	27, 169
SfcI	CTRYAG	1 cut(s)	211
SgeI	CNNG	7 cut(s)	63, 88, 139, 176, 206, 236, 238
SinI	GGWCC	1 cut(s)	104
SmlI	CTYRAG	1 cut(s)	162
SmoI	CTYRAG	1 cut(s)	162
SsiI	CCGC	1 cut(s)	177
TaaI	ACNGT	2 cut(s)	113, 215
TaqI	TCGA	2 cut(s)	71, 139
TatI	WGTACW	1 cut(s)	64
TscAI	CASTG	1 cut(s)	220
TspGWI	ACGGA	1 cut(s)	125
TspRI	CASTG	1 cut(s)	220
Van91I	CCANNNNNTGG	1 cut(s)	113
VpaK11BI	GGWCC	1 cut(s)	104

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.