Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008990.1

Orthogroup ID

OG0003073

Physical Location & Seq

Genomic Coordinates Forward (+)

10779 .. 11297

Gene Structure 519 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008990.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 462 bp

atgtttctgcctctcaaaagagagctttctcctccacttcctctctacgctggtggaggctgtgtagtttcgatctggaaagatggctttgcctccttctatggtccaaactgtggtggtggagacgggctcctccgtcgaaatctgcctaaatctctctctcaagcttctgatggcggaagtgagggtgatctgagagctgatggatctgatcggatctggaatttggcttacaagaggatgagttttccggctgatggtaacgcttactggcatggctgggatcgatcgtttttgttggaggacaatgggatcagttgtgctctcgattcttctttgccggcagaggtggatgacgggctggcattgggcgtcgagtatggtggtgggattcgtcatcttctgctcaaatgggatccatttttgtccgggtttcttgctagtatgggtggtggtctttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

153

Amino Acids

16.34

Weight (kDa)

4.87

Isoelectric Point (pI)

55.01

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003073)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr0c29g0501151 RchiOBHm_Chr1g0314121 RchiOBHm_Chr3g0465601 RchiOBHm_Chr3g0471431 RchiOBHm_Chr4g0414901
rosa_laevigata	RLG00000009299 RLG00000019736 RLG00000034336
rosa_multiflora	Rmu_sc0008611.1_g000006 Rmu_sc0008990.1_g000005 Rmu_sc0016988.1_g000001
rosa_roxburghii	Rroxscaffold_2G00140650 Rroxscaffold_3G00232870 Rroxscaffold_4G00298360 Rroxscaffold_6G00410590 Rroxscaffold_7G00190580
rosa_rugosa	Rorug05G0514000 Rorug06G0152500
rosa_samantha	Rh1AG063100 Rh1CG057100 Rh1DG060900 Rh2AG300600 Rh2AG507500 Rh2AG675700 Rh2BG139500 Rh2BG251500 Rh2BG308300 Rh2DG324800 Rh3AG108200 Rh3BG141000 Rh3CG113900 Rh4AG220200 Rh5AG334300 Rh5AG484600 Rh5CG560700 Rh5DG220200 Rh6BG336400 Rh7AG393300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	113
AciI	CCGC	1 cut(s)	177
AclWI	GGATC	6 cut(s)	214, 224, 291, 320, 410, 423
AcsI	RAATTY	1 cut(s)	223
AcyI	GRCGYC	1 cut(s)	372
AfiI	CCNNNNNNNGG	2 cut(s)	113, 257
AluBI	AGCT	3 cut(s)	25, 167, 200
AluI	AGCT	3 cut(s)	25, 167, 200
Alw21I	GWGCWC	1 cut(s)	325
Alw26I	GTCTC	1 cut(s)	117
AlwI	GGATC	6 cut(s)	214, 224, 291, 320, 410, 423
ApoI	RAATTY	1 cut(s)	223
AspS9I	GGNCC	1 cut(s)	104
AsuC2I	CCSGG	1 cut(s)	430
AsuHPI	GGTGA	1 cut(s)	200
AvaII	GGWCC	1 cut(s)	104
BamHI	GGATCC	1 cut(s)	415
BanII	GRGCYC	1 cut(s)	132
Bbv12I	GWGCWC	1 cut(s)	325
BccI	CCATC	4 cut(s)	77, 167, 197, 251
BcnI	CCSGG	1 cut(s)	430
BcoDI	GTCTC	1 cut(s)	117
BfaI	CTAG	1 cut(s)	441
Bme1390I	CCNGG	1 cut(s)	430
Bme18I	GGWCC	1 cut(s)	104
BmgT120I	GGNCC	1 cut(s)	104
BmiI	GGNNCC	2 cut(s)	131, 417
BmrFI	CCNGG	1 cut(s)	430
BplI	GAGNNNNNCTC	2 cut(s)	114, 146
BpuEI	CTTGAG	1 cut(s)	147
BpuMI	CCSGG	1 cut(s)	430
Bsa29I	ATCGAT	1 cut(s)	286
BsaHI	GRCGYC	1 cut(s)	372
BsaXI	ACNNNNNCTCC	2 cut(s)	48, 78
Bsc4I	CCNNNNNNNGG	2 cut(s)	113, 257
Bse118I	RCCGGY	1 cut(s)	340
Bse1I	ACTGG	1 cut(s)	275
BseCI	ATCGAT	1 cut(s)	286
BseGI	GGATG	2 cut(s)	246, 358
BseLI	CCNNNNNNNGG	2 cut(s)	113, 257
BseMII	CTCAG	1 cut(s)	185
BseNI	ACTGG	1 cut(s)	275
BseRI	GAGGAG	2 cut(s)	21, 122
BseYI	CCCAGC	1 cut(s)	279
Bsh1285I	CGRYCG	1 cut(s)	290
BshVI	ATCGAT	1 cut(s)	286
BsiEI	CGRYCG	1 cut(s)	290
BsiHKAI	GWGCWC	1 cut(s)	325
BsiSI	CCGG	3 cut(s)	251, 341, 429
BslI	CCNNNNNNNGG	2 cut(s)	113, 257
BsmAI	GTCTC	1 cut(s)	117
BsmBI	CGTCTC	1 cut(s)	117
Bsp1286I	GDGCHC	2 cut(s)	132, 325
Bsp143I	GATC	9 cut(s)	72, 190, 206, 211, 216, 283, 287, 312, 415
BspACI	CCGC	1 cut(s)	177
BspCNI	CTCAG	1 cut(s)	186
BspDI	ATCGAT	1 cut(s)	286
BspLI	GGNNCC	2 cut(s)	131, 417
BspPI	GGATC	6 cut(s)	214, 224, 291, 320, 410, 423
BsrFI	RCCGGY	1 cut(s)	340
BsrI	ACTGG	1 cut(s)	275
BssAI	RCCGGY	1 cut(s)	340
BssMI	GATC	9 cut(s)	72, 190, 206, 211, 216, 283, 287, 312, 415
BssNI	GRCGYC	1 cut(s)	372
Bst4CI	ACNGT	1 cut(s)	113
BstACI	GRCGYC	1 cut(s)	372
BstC8I	GCNNGC	2 cut(s)	342, 363
BstDEI	CTNAG	1 cut(s)	194
BstF5I	GGATG	2 cut(s)	246, 358
BstKTI	GATC	9 cut(s)	75, 193, 209, 214, 219, 286, 290, 315, 418
BstMAI	GTCTC	1 cut(s)	117
BstMBI	GATC	9 cut(s)	72, 190, 206, 211, 216, 283, 287, 312, 415
BstMCI	CGRYCG	1 cut(s)	290
BstSCI	CCNGG	1 cut(s)	428
BstX2I	RGATCY	3 cut(s)	206, 216, 415
BstYI	RGATCY	3 cut(s)	206, 216, 415
Bsu15I	ATCGAT	1 cut(s)	286
BsuTUI	ATCGAT	1 cut(s)	286
BtsCI	GGATG	2 cut(s)	246, 358
Cac8I	GCNNGC	2 cut(s)	342, 363
Cfr10I	RCCGGY	1 cut(s)	340
Cfr13I	GGNCC	1 cut(s)	104
ClaI	ATCGAT	1 cut(s)	286
CseI	GACGC	1 cut(s)	361
CviAII	CATG	1 cut(s)	275
DdeI	CTNAG	1 cut(s)	194
DpnI	GATC	9 cut(s)	74, 192, 208, 213, 218, 285, 289, 314, 417
DpnII	GATC	9 cut(s)	72, 190, 206, 211, 216, 283, 287, 312, 415
EciI	GGCGGA	1 cut(s)	192
Eco24I	GRGCYC	1 cut(s)	132
Eco47I	GGWCC	1 cut(s)	104
EcoT38I	GRGCYC	1 cut(s)	132
Esp3I	CGTCTC	1 cut(s)	117
FaeI	CATG	1 cut(s)	278
FaiI	YATR	4 cut(s)	102, 276, 381, 446
FatI	CATG	1 cut(s)	274
FokI	GGATG	2 cut(s)	253, 365
FriOI	GRGCYC	1 cut(s)	132
FspBI	CTAG	1 cut(s)	441
GsaI	CCCAGC	1 cut(s)	283
HapII	CCGG	3 cut(s)	251, 341, 429
HgaI	GACGC	1 cut(s)	361
Hin1I	GRCGYC	1 cut(s)	372
Hin1II	CATG	1 cut(s)	278
HindIII	AAGCTT	1 cut(s)	165
HinfI	GANTC	2 cut(s)	329, 391
HpaII	CCGG	3 cut(s)	251, 341, 429
HphI	GGTGA	1 cut(s)	200
Hpy188I	TCNGA	4 cut(s)	172, 195, 211, 216
Hpy188III	TCNNGA	3 cut(s)	76, 220, 326
Hpy99I	CGWCG	2 cut(s)	141, 377
HpyAV	CCTTC	1 cut(s)	106
HpyCH4III	ACNGT	1 cut(s)	113
HpyF3I	CTNAG	1 cut(s)	194
Hsp92I	GRCGYC	1 cut(s)	372
Hsp92II	CATG	1 cut(s)	278
KroI	GCCGGC	1 cut(s)	340
KroNI	GCCGGC	1 cut(s)	342
Kzo9I	GATC	9 cut(s)	72, 190, 206, 211, 216, 283, 287, 312, 415
LmnI	GCTCC	1 cut(s)	135
LpnPI	CCDG	9 cut(s)	36, 61, 205, 256, 264, 265, 347, 354, 442
MaeI	CTAG	1 cut(s)	441
MaeIII	GTNAC	1 cut(s)	260
MalI	GATC	9 cut(s)	74, 192, 208, 213, 218, 285, 289, 314, 417
MboI	GATC	9 cut(s)	72, 190, 206, 211, 216, 283, 287, 312, 415
MboII	GAAGA	2 cut(s)	324, 392
MflI	RGATCY	3 cut(s)	206, 216, 415
MhlI	GDGCHC	2 cut(s)	132, 325
MluCI	AATT	1 cut(s)	223
MmeI	TCCRAC	1 cut(s)	279
MroNI	GCCGGC	1 cut(s)	340
MspI	CCGG	3 cut(s)	251, 341, 429
MspR9I	CCNGG	1 cut(s)	430
NaeI	GCCGGC	1 cut(s)	342
NciI	CCSGG	1 cut(s)	430
NdeII	GATC	9 cut(s)	72, 190, 206, 211, 216, 283, 287, 312, 415
NgoMIV	GCCGGC	1 cut(s)	340
NlaIII	CATG	1 cut(s)	278
NlaIV	GGNNCC	2 cut(s)	131, 417
PdiI	GCCGGC	1 cut(s)	342
PfeI	GAWTC	2 cut(s)	329, 391
PflMI	CCANNNNNTGG	1 cut(s)	113
Ple19I	CGATCG	1 cut(s)	290
PspFI	CCCAGC	1 cut(s)	279
PspN4I	GGNNCC	2 cut(s)	131, 417
PspPI	GGNCC	1 cut(s)	104
PsuI	RGATCY	3 cut(s)	206, 216, 415
PvuI	CGATCG	1 cut(s)	290
Sau3AI	GATC	9 cut(s)	72, 190, 206, 211, 216, 283, 287, 312, 415
Sau96I	GGNCC	1 cut(s)	104
ScrFI	CCNGG	1 cut(s)	430
SduI	GDGCHC	2 cut(s)	132, 325
SetI	ASST	4 cut(s)	27, 169, 202, 351
SinI	GGWCC	1 cut(s)	104
SmlI	CTYRAG	1 cut(s)	162
SmoI	CTYRAG	1 cut(s)	162
Sse9I	AATT	1 cut(s)	223
SsiI	CCGC	1 cut(s)	177
SspMI	CTAG	1 cut(s)	441
StyD4I	CCNGG	1 cut(s)	428
TaaI	ACNGT	1 cut(s)	113
TaqI	TCGA	5 cut(s)	71, 139, 286, 327, 375
TasI	AATT	1 cut(s)	223
TfiI	GAWTC	2 cut(s)	329, 391
TspGWI	ACGGA	1 cut(s)	125
Van91I	CCANNNNNTGG	1 cut(s)	113
VpaK11BI	GGWCC	1 cut(s)	104
XapI	RAATTY	1 cut(s)	223
XspI	CTAG	1 cut(s)	441

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.