Rh2AG300600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
37583732 .. 37599973
16242 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG300600.1

Sequence Viewer

Length: 339 bp
ATGACTAAGCAGGTTCCAAAGGCTTTGGAGGGAGATGTGAAACGAGCTTTGGAGCTTGCCATTGATGAGGAATCCCCTGTAGAGAGTCCATGGATACTGAGGCTAAGATACCAGTACAGAGGCTTTGGTTCTGTTTCCAAGAACACTCAATTGAATCCTGATAAGTTTATTACTCAGTCAATCTGGGCAAACATCTTCTTTGCGCTTAGGTTCTTTGCCTTTTGTTCCCAACTAGATAGTAAGTATTGCCAGAGCCACCACAGTTGCAGTATATTTCTTGCAGAAGTATTAAGACAACAATGTGCGCTTGGGCTATTGAGTAAAGTTGAGAGTTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

12.81

Weight (kDa)

8.4

Isoelectric Point (pI)

53.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 116
AgsI TTSAA 1 cut(s) 154
AjuI GAANNNNNNNTTGG 2 cut(s) 32, 64
AluBI AGCT 2 cut(s) 47, 55
AluI AGCT 2 cut(s) 47, 55
AspLEI GCGC 2 cut(s) 205, 307
BciVI GTATCC 1 cut(s) 87
BfaI CTAG 1 cut(s) 233
BfmI CTRYAG 1 cut(s) 78
BfuI GTATCC 1 cut(s) 87
BmiI GGNNCC 1 cut(s) 15
Bpu10I CCTNAGC 1 cut(s) 206
BsaJI CCNNGG 1 cut(s) 89
Bse1I ACTGG 1 cut(s) 112
BseDI CCNNGG 1 cut(s) 89
BseMII CTCAG 2 cut(s) 89, 188
BseNI ACTGG 1 cut(s) 112
Bsp19I CCATGG 1 cut(s) 89
BspCNI CTCAG 2 cut(s) 90, 187
BspLI GGNNCC 1 cut(s) 15
BsrI ACTGG 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 89
BssT1I CCWWGG 1 cut(s) 89
Bst4CI ACNGT 1 cut(s) 263
BstC8I GCNNGC 1 cut(s) 57
BstDEI CTNAG 5 cut(s) 6, 98, 104, 174, 206
BstDSI CCRYGG 1 cut(s) 89
BstHHI GCGC 2 cut(s) 205, 307
BstSFI CTRYAG 1 cut(s) 78
BsuI GTATCC 1 cut(s) 87
BtgI CCRYGG 1 cut(s) 89
Cac8I GCNNGC 1 cut(s) 57
CfoI GCGC 2 cut(s) 205, 307
Csp6I GTAC 1 cut(s) 115
CspCI CAANNNNNGTGG 2 cut(s) 245, 280
CviAII CATG 1 cut(s) 90
CviJI RGCY 7 cut(s) 23, 47, 55, 103, 123, 255, 313
CviKI_1 RGCY 7 cut(s) 23, 47, 55, 103, 123, 255, 313
CviQI GTAC 1 cut(s) 115
DdeI CTNAG 5 cut(s) 6, 98, 104, 174, 206
Eco130I CCWWGG 1 cut(s) 89
EcoT14I CCWWGG 1 cut(s) 89
ErhI CCWWGG 1 cut(s) 89
FaeI CATG 1 cut(s) 93
FaiI YATR 3 cut(s) 91, 272, 337
FatI CATG 1 cut(s) 89
FspBI CTAG 1 cut(s) 233
GlaI GCGC 2 cut(s) 204, 306
HhaI GCGC 2 cut(s) 205, 307
Hin1II CATG 1 cut(s) 93
Hin6I GCGC 2 cut(s) 203, 305
HinP1I GCGC 2 cut(s) 203, 305
HinfI GANTC 3 cut(s) 71, 85, 154
Hpy188III TCNNGA 1 cut(s) 158
HpyCH4III ACNGT 1 cut(s) 263
HpyCH4V TGCA 2 cut(s) 267, 281
HpyF3I CTNAG 5 cut(s) 6, 98, 104, 174, 206
Hsp92II CATG 1 cut(s) 93
HspAI GCGC 2 cut(s) 203, 305
LmnI GCTCC 1 cut(s) 52
LpnPI CCDG 5 cut(s) 90, 125, 169, 171, 263
MaeI CTAG 1 cut(s) 233
MboII GAAGA 1 cut(s) 187
MfeI CAATTG 1 cut(s) 149
MluCI AATT 1 cut(s) 149
MlyI GAGTC 1 cut(s) 94
MnlI CCTC 4 cut(s) 22, 61, 93, 113
MseI TTAA 1 cut(s) 290
MunI CAATTG 1 cut(s) 149
NcoI CCATGG 1 cut(s) 89
NlaIII CATG 1 cut(s) 93
NlaIV GGNNCC 1 cut(s) 15
PfeI GAWTC 2 cut(s) 71, 154
PleI GAGTC 1 cut(s) 93
PpsI GAGTC 1 cut(s) 93
PspN4I GGNNCC 1 cut(s) 15
RsaI GTAC 1 cut(s) 116
RsaNI GTAC 1 cut(s) 115
SaqAI TTAA 1 cut(s) 290
SchI GAGTC 1 cut(s) 94
SetI ASST 4 cut(s) 15, 49, 57, 212
SfcI CTRYAG 1 cut(s) 78
Sse9I AATT 1 cut(s) 149
SspMI CTAG 1 cut(s) 233
StyI CCWWGG 1 cut(s) 89
TaaI ACNGT 1 cut(s) 263
TasI AATT 1 cut(s) 149
TatI WGTACW 1 cut(s) 114
TfiI GAWTC 2 cut(s) 71, 154
Tru1I TTAA 1 cut(s) 290
Tru9I TTAA 1 cut(s) 290
TspDTI ATGAA 1 cut(s) 324
XspI CTAG 1 cut(s) 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.