Rh4AG220200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
51833092 .. 51835945
2854 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG220200.1

Sequence Viewer

Length: 198 bp
ATGGTGTCTCATAAAACAAAAGTGAATGACAAGCTAGATGTGCAGTACCTTCATCTTAAAGTAGCTAATGATTCCAGCATAGGCCTTAACCCAACCCCTCTTTTTACAGTTACCCAGCAACAATTGGAAGTAAGGATATTAGTTTGTTTGGTGAAATTGGAATTGAAGTCCATATTAGGTATGCCATTACATTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.3

Weight (kDa)

8.93

Isoelectric Point (pI)

27.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 47
AgsI TTSAA 1 cut(s) 166
AluBI AGCT 2 cut(s) 34, 65
AluI AGCT 2 cut(s) 34, 65
Alw26I GTCTC 1 cut(s) 12
AoxI GGCC 1 cut(s) 82
AsuHPI GGTGA 1 cut(s) 163
BcoDI GTCTC 1 cut(s) 12
BfaI CTAG 1 cut(s) 35
BseYI CCCAGC 1 cut(s) 114
BsgI GTGCAG 1 cut(s) 62
BshFI GGCC 1 cut(s) 84
BsmAI GTCTC 1 cut(s) 12
BsnI GGCC 1 cut(s) 84
BspANI GGCC 1 cut(s) 84
Bst4CI ACNGT 1 cut(s) 109
BstMAI GTCTC 1 cut(s) 12
BstMWI GCNNNNNNNGC 1 cut(s) 40
BsuRI GGCC 1 cut(s) 84
Csp6I GTAC 1 cut(s) 46
CviJI RGCY 3 cut(s) 34, 65, 84
CviKI_1 RGCY 3 cut(s) 34, 65, 84
CviQI GTAC 1 cut(s) 46
Eco147I AGGCCT 1 cut(s) 84
FaiI YATR 4 cut(s) 12, 80, 173, 182
FspBI CTAG 1 cut(s) 35
GsaI CCCAGC 1 cut(s) 118
HaeIII GGCC 1 cut(s) 84
HinfI GANTC 1 cut(s) 71
HphI GGTGA 1 cut(s) 163
Hpy188III TCNNGA 1 cut(s) 195
HpyAV CCTTC 1 cut(s) 59
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 1 cut(s) 43
HpyF10VI GCNNNNNNNGC 1 cut(s) 40
LpnPI CCDG 2 cut(s) 88, 128
MaeI CTAG 1 cut(s) 35
MaeIII GTNAC 1 cut(s) 109
MfeI CAATTG 1 cut(s) 122
MluCI AATT 3 cut(s) 122, 155, 161
MnlI CCTC 1 cut(s) 108
MseI TTAA 2 cut(s) 57, 87
MunI CAATTG 1 cut(s) 122
MwoI GCNNNNNNNGC 1 cut(s) 40
PceI AGGCCT 1 cut(s) 84
PfeI GAWTC 1 cut(s) 71
PspFI CCCAGC 1 cut(s) 114
RsaI GTAC 1 cut(s) 47
RsaNI GTAC 1 cut(s) 46
SaqAI TTAA 2 cut(s) 57, 87
SetI ASST 4 cut(s) 36, 51, 67, 181
SgeI CNNG 4 cut(s) 43, 47, 87, 127
Sse9I AATT 3 cut(s) 122, 155, 161
SseBI AGGCCT 1 cut(s) 84
SspMI CTAG 1 cut(s) 35
StuI AGGCCT 1 cut(s) 84
TaaI ACNGT 1 cut(s) 109
TasI AATT 3 cut(s) 122, 155, 161
TfiI GAWTC 1 cut(s) 71
Tru1I TTAA 2 cut(s) 57, 87
Tru9I TTAA 2 cut(s) 57, 87
TspDTI ATGAA 1 cut(s) 41
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.