RchiOBHm_Chr5g0034681

Histone deacetylase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
28554706 .. 28556201
1496 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31365

Sequence Viewer

Length: 141 bp
ATGGGCCATCAATGTGGGAGGACTGGGTTTTATCATTGTTGTAGGGGAAAAGGAGGTGGATTATGTGCTTATACCGATATTTCTCTTTGCATACATTTTCTGCAGGTGCCGTTAAACATACTCAAGGGTGATGATTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

46

Amino Acids

5.06

Weight (kDa)

7.66

Isoelectric Point (pI)

34.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 94
Acc36I ACCTGC 1 cut(s) 94
AccB1I GGYRCC 1 cut(s) 106
AoxI GGCC 1 cut(s) 4
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 140
BanI GGYRCC 1 cut(s) 106
BccI CCATC 1 cut(s) 15
BceAI ACGGC 1 cut(s) 94
BfmI CTRYAG 1 cut(s) 101
BfuAI ACCTGC 1 cut(s) 94
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 108
BmrI ACTGGG 1 cut(s) 33
BmuI ACTGGG 1 cut(s) 33
BpuEI CTTGAG 1 cut(s) 107
Bse1I ACTGG 1 cut(s) 28
BseNI ACTGG 1 cut(s) 28
BshFI GGCC 1 cut(s) 6
BshNI GGYRCC 1 cut(s) 106
BsnI GGCC 1 cut(s) 6
BspANI GGCC 1 cut(s) 6
BspLI GGNNCC 1 cut(s) 108
BspMAI CTGCAG 1 cut(s) 105
BspMI ACCTGC 1 cut(s) 94
BspT107I GGYRCC 1 cut(s) 106
BsrI ACTGG 1 cut(s) 28
BstSFI CTRYAG 1 cut(s) 101
BstXI CCANNNNNNTGG 1 cut(s) 14
BsuRI GGCC 1 cut(s) 6
BveI ACCTGC 1 cut(s) 94
Cfr13I GGNCC 1 cut(s) 4
CviJI RGCY 1 cut(s) 6
CviKI_1 RGCY 1 cut(s) 6
FaiI YATR 4 cut(s) 64, 72, 92, 119
HaeIII GGCC 1 cut(s) 6
HphI GGTGA 1 cut(s) 140
HpyCH4V TGCA 2 cut(s) 90, 103
LpnPI CCDG 2 cut(s) 9, 89
MnlI CCTC 2 cut(s) 12, 47
MseI TTAA 2 cut(s) 113, 139
MslI CAYNNNNRTG 1 cut(s) 12
NlaIV GGNNCC 1 cut(s) 108
PaqCI CACCTGC 1 cut(s) 94
PspN4I GGNNCC 1 cut(s) 108
PspPI GGNCC 1 cut(s) 4
PstI CTGCAG 1 cut(s) 105
RseI CAYNNNNRTG 1 cut(s) 12
SaqAI TTAA 2 cut(s) 113, 139
Sau96I GGNCC 1 cut(s) 4
SetI ASST 2 cut(s) 58, 108
SfcI CTRYAG 1 cut(s) 101
SgeI CNNG 3 cut(s) 36, 116, 136
SmiMI CAYNNNNRTG 1 cut(s) 12
SmlI CTYRAG 1 cut(s) 122
SmoI CTYRAG 1 cut(s) 122
Tru1I TTAA 2 cut(s) 113, 139
Tru9I TTAA 2 cut(s) 113, 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.