RchiOBHm_Chr6g0254041

PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
9106176 .. 9110636
4461 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22784

Sequence Viewer

Length: 204 bp
ATGATTCAAGGAGGGGACTTCGATAAGGGCAATGGTACTGGAGGCAAAAGCATTTATGGGCGTACATTTAAAGATGAGAACTTTAAGTTGCTTCATACTGGACCAGGAGTTCTTAGCATGGCAAATGCAGGCCCCAATACCAATGGAAGTCAATTCTTCATATGCACAGTACAGTTTTGGAAGGCATGGAAATTGTTAGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.26

Weight (kDa)

9.36

Isoelectric Point (pI)

-5.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pro_isomerase PF00160 1 - 57 5.1e-14 Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 3 cut(s) 37, 64, 171
AgsI TTSAA 1 cut(s) 8
AjnI CCWGG 1 cut(s) 103
AloI GAACNNNNNNTCC 2 cut(s) 93, 125
AoxI GGCC 1 cut(s) 130
AspS9I GGNCC 2 cut(s) 101, 131
AvaII GGWCC 1 cut(s) 101
BciT130I CCWGG 1 cut(s) 105
Bme1390I CCNGG 1 cut(s) 105
Bme18I GGWCC 1 cut(s) 101
BmgT120I GGNCC 2 cut(s) 101, 131
BmiI GGNNCC 1 cut(s) 133
BmrFI CCNGG 1 cut(s) 105
BpmI CTGGAG 1 cut(s) 60
Bse1I ACTGG 2 cut(s) 43, 103
Bse3DI GCAATG 1 cut(s) 37
BseBI CCWGG 1 cut(s) 105
BseMI GCAATG 1 cut(s) 37
BseNI ACTGG 2 cut(s) 43, 103
BshFI GGCC 1 cut(s) 132
BslFI GGGAC 1 cut(s) 29
BsmFI GGGAC 1 cut(s) 29
BsnI GGCC 1 cut(s) 132
BspANI GGCC 1 cut(s) 132
BspLI GGNNCC 1 cut(s) 133
BsrDI GCAATG 1 cut(s) 37
BsrI ACTGG 2 cut(s) 43, 103
Bst2UI CCWGG 1 cut(s) 105
Bst4CI ACNGT 2 cut(s) 169, 174
BstC8I GCNNGC 1 cut(s) 130
BstDEI CTNAG 1 cut(s) 113
BstNI CCWGG 1 cut(s) 105
BstSCI CCNGG 1 cut(s) 103
BsuRI GGCC 1 cut(s) 132
Cac8I GCNNGC 1 cut(s) 130
Cfr13I GGNCC 2 cut(s) 101, 131
Csp6I GTAC 3 cut(s) 36, 63, 170
CviAII CATG 2 cut(s) 118, 186
CviJI RGCY 2 cut(s) 132, 201
CviKI_1 RGCY 2 cut(s) 132, 201
CviQI GTAC 3 cut(s) 36, 63, 170
DdeI CTNAG 1 cut(s) 113
DraI TTTAAA 1 cut(s) 70
Eco47I GGWCC 1 cut(s) 101
EcoO109I RGGNCCY 1 cut(s) 131
EcoRII CCWGG 1 cut(s) 103
FaeI CATG 2 cut(s) 121, 189
FaiI YATR 6 cut(s) 57, 96, 119, 161, 163, 187
FaqI GGGAC 1 cut(s) 29
FatI CATG 2 cut(s) 117, 185
FauNDI CATATG 1 cut(s) 161
GsuI CTGGAG 1 cut(s) 60
HaeIII GGCC 1 cut(s) 132
Hin1II CATG 2 cut(s) 121, 189
HinfI GANTC 1 cut(s) 4
HpyAV CCTTC 1 cut(s) 175
HpyCH4III ACNGT 2 cut(s) 169, 174
HpyCH4V TGCA 2 cut(s) 128, 165
HpyF3I CTNAG 1 cut(s) 113
Hsp92II CATG 2 cut(s) 121, 189
LpnPI CCDG 5 cut(s) 24, 84, 90, 114, 117
MboII GAAGA 1 cut(s) 148
MluCI AATT 2 cut(s) 152, 191
MnlI CCTC 2 cut(s) 5, 35
MseI TTAA 2 cut(s) 69, 84
MspR9I CCNGG 1 cut(s) 105
MvaI CCWGG 1 cut(s) 105
NdeI CATATG 1 cut(s) 161
NlaIII CATG 2 cut(s) 121, 189
NlaIV GGNNCC 1 cut(s) 133
PfeI GAWTC 1 cut(s) 4
Psp6I CCWGG 1 cut(s) 103
PspGI CCWGG 1 cut(s) 103
PspN4I GGNNCC 1 cut(s) 133
PspPI GGNCC 2 cut(s) 101, 131
RsaI GTAC 3 cut(s) 37, 64, 171
RsaNI GTAC 3 cut(s) 36, 63, 170
SaqAI TTAA 2 cut(s) 69, 84
Sau96I GGNCC 2 cut(s) 101, 131
ScrFI CCNGG 1 cut(s) 105
SgeI CNNG 8 cut(s) 20, 51, 111, 116, 117, 130, 141, 198
SinI GGWCC 1 cut(s) 101
Sse9I AATT 2 cut(s) 152, 191
StyD4I CCNGG 1 cut(s) 103
TaaI ACNGT 2 cut(s) 169, 174
TaqI TCGA 1 cut(s) 21
TasI AATT 2 cut(s) 152, 191
TatI WGTACW 1 cut(s) 169
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 2 cut(s) 69, 84
Tru9I TTAA 2 cut(s) 69, 84
TspDTI ATGAA 2 cut(s) 83, 148
VpaK11BI GGWCC 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.