Rh1AG363000

PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
59758312 .. 59758723
412 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG363000.1

Sequence Viewer

Length: 153 bp
ATGGCAAATTCTGGCCAAGACACCAATGGATCACAGTTCTTCATCACGACTGTCAAAACTAGCTGGTCGGATGGTCACCATGTTGTATTTGGCAAGGTGCTTTCTGGAATGGACGTTGAGTACAAGGTTGAACGAGTAGGAGGATCGGATTAG

Protein Analysis

50

Amino Acids

5.41

Weight (kDa)

5.43

Isoelectric Point (pI)

4.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pro_isomerase PF00160 1 - 46 7.9e-15 Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 37, 151
AcoI YGGCCR 1 cut(s) 13
AcsI RAATTY 1 cut(s) 7
AfaI GTAC 1 cut(s) 122
AgsI TTSAA 1 cut(s) 131
AluBI AGCT 1 cut(s) 63
AluI AGCT 1 cut(s) 63
AlwI GGATC 2 cut(s) 37, 151
AoxI GGCC 1 cut(s) 13
ApoI RAATTY 1 cut(s) 7
AsuHPI GGTGA 1 cut(s) 68
BalI TGGCCA 1 cut(s) 15
BccI CCATC 1 cut(s) 65
BfaI CTAG 1 cut(s) 60
BseGI GGATG 1 cut(s) 76
BshFI GGCC 1 cut(s) 15
BsnI GGCC 1 cut(s) 15
Bsp143I GATC 2 cut(s) 29, 143
BspANI GGCC 1 cut(s) 15
BspPI GGATC 2 cut(s) 37, 151
BssMI GATC 2 cut(s) 29, 143
Bst4CI ACNGT 2 cut(s) 36, 52
BstEII GGTNACC 1 cut(s) 74
BstF5I GGATG 1 cut(s) 76
BstKTI GATC 2 cut(s) 32, 146
BstMBI GATC 2 cut(s) 29, 143
BstPI GGTNACC 1 cut(s) 74
BsuRI GGCC 1 cut(s) 15
BtsCI GGATG 1 cut(s) 76
Csp6I GTAC 1 cut(s) 121
CviAII CATG 1 cut(s) 80
CviJI RGCY 2 cut(s) 15, 63
CviKI_1 RGCY 2 cut(s) 15, 63
CviQI GTAC 1 cut(s) 121
DpnI GATC 2 cut(s) 31, 145
DpnII GATC 2 cut(s) 29, 143
EaeI YGGCCR 1 cut(s) 13
Eco91I GGTNACC 1 cut(s) 74
EcoO65I GGTNACC 1 cut(s) 74
FaeI CATG 1 cut(s) 83
FaiI YATR 1 cut(s) 81
FatI CATG 1 cut(s) 79
FokI GGATG 1 cut(s) 83
FspBI CTAG 1 cut(s) 60
HaeIII GGCC 1 cut(s) 15
Hin1II CATG 1 cut(s) 83
HphI GGTGA 1 cut(s) 68
Hpy188I TCNGA 2 cut(s) 70, 148
Hpy188III TCNNGA 2 cut(s) 46, 105
HpyCH4III ACNGT 2 cut(s) 36, 52
HpyCH4IV ACGT 1 cut(s) 114
HpySE526I ACGT 1 cut(s) 114
Hsp92II CATG 1 cut(s) 83
Kzo9I GATC 2 cut(s) 29, 143
LpnPI CCDG 2 cut(s) 49, 90
MaeI CTAG 1 cut(s) 60
MaeII ACGT 1 cut(s) 114
MaeIII GTNAC 1 cut(s) 74
MalI GATC 2 cut(s) 31, 145
MboI GATC 2 cut(s) 29, 143
MboII GAAGA 1 cut(s) 31
MlsI TGGCCA 1 cut(s) 15
MluCI AATT 1 cut(s) 7
MluNI TGGCCA 1 cut(s) 15
MmeI TCCRAC 1 cut(s) 48
MnlI CCTC 1 cut(s) 134
Mox20I TGGCCA 1 cut(s) 15
MscI TGGCCA 1 cut(s) 15
Msp20I TGGCCA 1 cut(s) 15
NdeII GATC 2 cut(s) 29, 143
NlaIII CATG 1 cut(s) 83
NmuCI GTSAC 1 cut(s) 74
PspEI GGTNACC 1 cut(s) 74
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
Sau3AI GATC 2 cut(s) 29, 143
SetI ASST 4 cut(s) 65, 99, 117, 129
Sse9I AATT 1 cut(s) 7
SspMI CTAG 1 cut(s) 60
TaaI ACNGT 2 cut(s) 36, 52
TaiI ACGT 1 cut(s) 117
TasI AATT 1 cut(s) 7
TatI WGTACW 1 cut(s) 120
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
TspDTI ATGAA 1 cut(s) 31
XapI RAATTY 1 cut(s) 7
XcmI CCANNNNNNNNNTGG 2 cut(s) 23, 86
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.