Rmu_co7984260.1_g000001

divergent subfamily of APPLE domains

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7984260.1
Physical Location & Seq
Reverse (-)
1 .. 426
426 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7984260.1_g000001.1.cds

Sequence Viewer

Length: 337 bp
atgaacaacactgtatggtattctaatttttccacagtactcgaagatcctgttgcacagcttttggagactggaaattttgttgtcagagacaaggctacagcaggttcggaaagttttgtatggcagagttttgattccccatcggatacattgttagcagggatgaggcttggatgggatttcagaaccgggctcaacaagttcttgacttcttggaaaaatgctagtgatccatctcttggtgagtatacctataggattgttaatcttgctttgcctcagcttgttcttgctaagggatcggagaaagagtttcgaagtgggccctggaatg

Protein Analysis

112

Amino Acids

12.59

Weight (kDa)

4.99

Isoelectric Point (pI)

30.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 95
AccB7I CCANNNNNTGG 1 cut(s) 242
AccI GTMKAC 1 cut(s) 251
AclWI GGATC 3 cut(s) 41, 227, 310
AcsI RAATTY 1 cut(s) 76
AfaI GTAC 1 cut(s) 39
AfiI CCNNNNNNNGG 1 cut(s) 242
AjnI CCWGG 1 cut(s) 329
AluBI AGCT 2 cut(s) 61, 286
AluI AGCT 2 cut(s) 61, 286
Alw26I GTCTC 2 cut(s) 62, 84
AlwI GGATC 3 cut(s) 41, 227, 310
AoxI GGCC 1 cut(s) 326
ApaI GGGCCC 1 cut(s) 330
ApoI RAATTY 1 cut(s) 76
AspS9I GGNCC 2 cut(s) 326, 327
AsuC2I CCSGG 1 cut(s) 193
AsuHPI GGTGA 1 cut(s) 257
AsuII TTCGAA 1 cut(s) 319
BaeGI GKGCMC 1 cut(s) 330
BanII GRGCYC 2 cut(s) 198, 330
BbvCI CCTCAGC 1 cut(s) 282
BccI CCATC 3 cut(s) 151, 171, 244
BciT130I CCWGG 1 cut(s) 331
BciVI GTATCC 1 cut(s) 142
BcnI CCSGG 1 cut(s) 193
BcoDI GTCTC 2 cut(s) 62, 84
BfaI CTAG 1 cut(s) 228
BfmI CTRYAG 2 cut(s) 99, 256
BfuAI ACCTGC 1 cut(s) 95
BfuI GTATCC 1 cut(s) 142
BmcAI AGTACT 1 cut(s) 39
Bme1390I CCNGG 2 cut(s) 193, 331
BmgT120I GGNCC 2 cut(s) 326, 327
BmiI GGNNCC 1 cut(s) 328
BmrFI CCNGG 2 cut(s) 193, 331
Bpu10I CCTNAGC 2 cut(s) 282, 297
Bpu14I TTCGAA 1 cut(s) 319
BpuMI CCSGG 1 cut(s) 193
BsaJI CCNNGG 1 cut(s) 329
BsaXI ACNNNNNCTCC 2 cut(s) 299, 329
Bsc4I CCNNNNNNNGG 1 cut(s) 242
Bse1I ACTGG 1 cut(s) 76
BseBI CCWGG 1 cut(s) 331
BseDI CCNNGG 1 cut(s) 329
BseGI GGATG 2 cut(s) 171, 182
BseLI CCNNNNNNNGG 1 cut(s) 242
BseMII CTCAG 1 cut(s) 296
BseNI ACTGG 1 cut(s) 76
BseSI GKGCMC 1 cut(s) 330
BshFI GGCC 1 cut(s) 328
BsiSI CCGG 1 cut(s) 192
BslI CCNNNNNNNGG 1 cut(s) 242
BsmAI GTCTC 2 cut(s) 62, 84
BsnI GGCC 1 cut(s) 328
Bsp119I TTCGAA 1 cut(s) 319
Bsp120I GGGCCC 1 cut(s) 326
Bsp1286I GDGCHC 2 cut(s) 198, 330
Bsp143I GATC 3 cut(s) 46, 232, 302
BspANI GGCC 1 cut(s) 328
BspCNI CTCAG 1 cut(s) 295
BspLI GGNNCC 1 cut(s) 328
BspMI ACCTGC 1 cut(s) 95
BspPI GGATC 3 cut(s) 41, 227, 310
BspT104I TTCGAA 1 cut(s) 319
BsrI ACTGG 1 cut(s) 76
BssECI CCNNGG 1 cut(s) 329
BssMI GATC 3 cut(s) 46, 232, 302
BssNAI GTATAC 1 cut(s) 252
Bst1107I GTATAC 1 cut(s) 252
Bst2UI CCWGG 1 cut(s) 331
Bst4CI ACNGT 2 cut(s) 13, 37
BstBI TTCGAA 1 cut(s) 319
BstDEI CTNAG 2 cut(s) 282, 297
BstF5I GGATG 2 cut(s) 171, 182
BstKTI GATC 3 cut(s) 49, 235, 305
BstMAI GTCTC 2 cut(s) 62, 84
BstMBI GATC 3 cut(s) 46, 232, 302
BstNI CCWGG 1 cut(s) 331
BstSCI CCNGG 2 cut(s) 191, 329
BstSFI CTRYAG 2 cut(s) 99, 256
BstSLI GKGCMC 1 cut(s) 330
BstX2I RGATCY 1 cut(s) 46
BstYI RGATCY 1 cut(s) 46
BstZ17I GTATAC 1 cut(s) 252
BsuI GTATCC 1 cut(s) 142
BsuRI GGCC 1 cut(s) 328
BtsCI GGATG 2 cut(s) 171, 182
BtsIMutI CAGTG 1 cut(s) 9
BveI ACCTGC 1 cut(s) 95
Cfr13I GGNCC 2 cut(s) 326, 327
Csp6I GTAC 1 cut(s) 38
CviJI RGCY 6 cut(s) 61, 98, 172, 196, 286, 328
CviKI_1 RGCY 6 cut(s) 61, 98, 172, 196, 286, 328
CviQI GTAC 1 cut(s) 38
DdeI CTNAG 2 cut(s) 282, 297
DpnI GATC 3 cut(s) 48, 234, 304
DpnII GATC 3 cut(s) 46, 232, 302
Eco24I GRGCYC 2 cut(s) 198, 330
EcoO109I RGGNCCY 1 cut(s) 327
EcoRII CCWGG 1 cut(s) 329
EcoT38I GRGCYC 2 cut(s) 198, 330
FaiI YATR 4 cut(s) 16, 124, 252, 258
FblI GTMKAC 1 cut(s) 251
FokI GGATG 2 cut(s) 178, 189
FriOI GRGCYC 2 cut(s) 198, 330
FspBI CTAG 1 cut(s) 228
HaeIII GGCC 1 cut(s) 328
HapII CCGG 1 cut(s) 192
HinfI GANTC 1 cut(s) 137
HpaII CCGG 1 cut(s) 192
HphI GGTGA 1 cut(s) 257
Hpy166II GTNNAC 1 cut(s) 252
Hpy188I TCNGA 5 cut(s) 89, 112, 148, 188, 307
Hpy188III TCNNGA 1 cut(s) 208
Hpy8I GTNNAC 1 cut(s) 252
HpyCH4III ACNGT 2 cut(s) 13, 37
HpyCH4V TGCA 1 cut(s) 56
HpyF3I CTNAG 2 cut(s) 282, 297
Kzo9I GATC 3 cut(s) 46, 232, 302
LpnPI CCDG 6 cut(s) 57, 63, 90, 147, 205, 316
MaeI CTAG 1 cut(s) 228
MalI GATC 3 cut(s) 48, 234, 304
MboI GATC 3 cut(s) 46, 232, 302
MboII GAAGA 1 cut(s) 56
MflI RGATCY 1 cut(s) 46
MhlI GDGCHC 2 cut(s) 198, 330
MluCI AATT 2 cut(s) 25, 76
MnlI CCTC 2 cut(s) 162, 291
MseI TTAA 1 cut(s) 267
MspI CCGG 1 cut(s) 192
MspR9I CCNGG 2 cut(s) 193, 331
MvaI CCWGG 1 cut(s) 331
NciI CCSGG 1 cut(s) 193
NdeII GATC 3 cut(s) 46, 232, 302
NlaIV GGNNCC 1 cut(s) 328
NspV TTCGAA 1 cut(s) 319
PfeI GAWTC 1 cut(s) 137
PflMI CCANNNNNTGG 1 cut(s) 242
Psp6I CCWGG 1 cut(s) 329
PspGI CCWGG 1 cut(s) 329
PspN4I GGNNCC 1 cut(s) 328
PspOMI GGGCCC 1 cut(s) 326
PspPI GGNCC 2 cut(s) 326, 327
PsuI RGATCY 1 cut(s) 46
RsaI GTAC 1 cut(s) 39
RsaNI GTAC 1 cut(s) 38
SaqAI TTAA 1 cut(s) 267
Sau3AI GATC 3 cut(s) 46, 232, 302
Sau96I GGNCC 2 cut(s) 326, 327
ScaI AGTACT 1 cut(s) 39
ScrFI CCNGG 2 cut(s) 193, 331
SduI GDGCHC 2 cut(s) 198, 330
SetI ASST 4 cut(s) 63, 109, 257, 288
SfcI CTRYAG 2 cut(s) 99, 256
SfuI TTCGAA 1 cut(s) 319
Sse9I AATT 2 cut(s) 25, 76
SspMI CTAG 1 cut(s) 228
StyD4I CCNGG 2 cut(s) 191, 329
TaaI ACNGT 2 cut(s) 13, 37
TaqI TCGA 2 cut(s) 42, 319
TasI AATT 2 cut(s) 25, 76
TatI WGTACW 1 cut(s) 37
TfiI GAWTC 1 cut(s) 137
Tru1I TTAA 1 cut(s) 267
Tru9I TTAA 1 cut(s) 267
TscAI CASTG 1 cut(s) 16
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 16
Van91I CCANNNNNTGG 1 cut(s) 242
XapI RAATTY 1 cut(s) 76
XmiI GTMKAC 1 cut(s) 251
XspI CTAG 1 cut(s) 228
ZrmI AGTACT 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.