Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8024538.1

Orthogroup ID

OG0002156

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 202

Gene Structure 201 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8024538.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 201 bp

atgtttgctagatgtggcgaccctcaaagtgtaatgaaggtgtttgataacatggcaagaagagatgtttctgcttggacagcagccattggagcaatggccatgcaaggaaatggggagcgagctatagagcttttcgatgacaggcttaagcaaggggtgaagccagatgaagtagtctttgtggcagtactaacagca

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

67

Amino Acids

7.33

Weight (kDa)

5.13

Isoelectric Point (pI)

29.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002156)

Species	Orthologous Gene IDs
malus_domestica	MD04G1086800.v1.1 MD15G1179900.v1.1
rosa_chinensis	RchiOBHm_Chr1g0319101 RchiOBHm_Chr1g0328871 RchiOBHm_Chr1g0329071 RchiOBHm_Chr1g0329121 RchiOBHm_Chr1g0329131 RchiOBHm_Chr3g0482401 RchiOBHm_Chr4g0386521 RchiOBHm_Chr4g0386661 RchiOBHm_Chr4g0386761 RchiOBHm_Chr4g0386771 RchiOBHm_Chr4g0386901 RchiOBHm_Chr4g0387051 RchiOBHm_Chr4g0387251 RchiOBHm_Chr4g0387261 RchiOBHm_Chr4g0389041 RchiOBHm_Chr4g0389121 RchiOBHm_Chr4g0389181 RchiOBHm_Chr4g0389271 RchiOBHm_Chr4g0389371 RchiOBHm_Chr4g0394511
rosa_laevigata	RLG00000009193 RLG00000009989 RLG00000009995 RLG00000010148 RLG00000010150 RLG00000010159
rosa_multiflora	Rmu_co8024538.1_g000001 Rmu_sc0002221.1_g000001 Rmu_sc0005233.1_g000001 Rmu_sc0006648.1_g000009 Rmu_sc0008380.1_g000013 Rmu_sc0018886.1_g000001 Rmu_sc0040950.1_g000001
rosa_roxburghii	Rroxscaffold_5G00335380
rosa_rugosa	Rorug03G0307400 Rorug03G0308300 Rorug03G0322800 Rorug03G0365000.1 Rorug03G0365100.1 Rorug05G0232600
rosa_samantha	Rh4CG016200
rosa_wichuraiana	Rw4G000010

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	99
AfaI	GTAC	1 cut(s)	192
AflII	CTTAAG	1 cut(s)	149
AluBI	AGCT	2 cut(s)	125, 133
AluI	AGCT	2 cut(s)	125, 133
AoxI	GGCC	1 cut(s)	99
ApeKI	GCWGC	1 cut(s)	83
AsuHPI	GGTGA	1 cut(s)	172
BalI	TGGCCA	1 cut(s)	101
BbvI	GCAGC	1 cut(s)	95
BfaI	CTAG	1 cut(s)	9
BfmI	CTRYAG	1 cut(s)	126
BfrI	CTTAAG	1 cut(s)	149
BisI	GCNGC	1 cut(s)	84
BlsI	GCNGC	1 cut(s)	85
BmcAI	AGTACT	1 cut(s)	192
Bse3DI	GCAATG	1 cut(s)	102
BseMI	GCAATG	1 cut(s)	102
BseXI	GCAGC	1 cut(s)	95
BshFI	GGCC	1 cut(s)	101
BsnI	GGCC	1 cut(s)	101
BspANI	GGCC	1 cut(s)	101
BspTI	CTTAAG	1 cut(s)	149
BsrDI	GCAATG	1 cut(s)	102
Bst6I	CTCTTC	1 cut(s)	55
BstAFI	CTTAAG	1 cut(s)	149
BstC8I	GCNNGC	1 cut(s)	123
BstMWI	GCNNNNNNNGC	2 cut(s)	80, 92
BstSFI	CTRYAG	1 cut(s)	126
BstV1I	GCAGC	1 cut(s)	95
BsuRI	GGCC	1 cut(s)	101
Cac8I	GCNNGC	1 cut(s)	123
Csp6I	GTAC	1 cut(s)	191
CviAII	CATG	2 cut(s)	52, 103
CviJI	RGCY	6 cut(s)	86, 101, 125, 133, 148, 166
CviKI_1	RGCY	6 cut(s)	86, 101, 125, 133, 148, 166
CviQI	GTAC	1 cut(s)	191
EaeI	YGGCCR	1 cut(s)	99
Eam1104I	CTCTTC	1 cut(s)	55
EarI	CTCTTC	1 cut(s)	55
FaeI	CATG	2 cut(s)	55, 106
FaiI	YATR	3 cut(s)	53, 104, 128
FatI	CATG	2 cut(s)	51, 102
Fnu4HI	GCNGC	1 cut(s)	84
Fsp4HI	GCNGC	1 cut(s)	84
FspBI	CTAG	1 cut(s)	9
GluI	GCNGC	1 cut(s)	84
HaeIII	GGCC	1 cut(s)	101
Hin1II	CATG	2 cut(s)	55, 106
HphI	GGTGA	1 cut(s)	172
HpyAV	CCTTC	1 cut(s)	31
HpyCH4V	TGCA	1 cut(s)	106
HpyF10VI	GCNNNNNNNGC	2 cut(s)	80, 92
Hsp92II	CATG	2 cut(s)	55, 106
LmnI	GCTCC	2 cut(s)	92, 118
LpnPI	CCDG	2 cut(s)	130, 180
Lsp1109I	GCAGC	1 cut(s)	95
MaeI	CTAG	1 cut(s)	9
MboII	GAAGA	1 cut(s)	72
MlsI	TGGCCA	1 cut(s)	101
MluNI	TGGCCA	1 cut(s)	101
MnlI	CCTC	1 cut(s)	33
Mox20I	TGGCCA	1 cut(s)	101
MscI	TGGCCA	1 cut(s)	101
MseI	TTAA	1 cut(s)	150
Msp20I	TGGCCA	1 cut(s)	101
MspCI	CTTAAG	1 cut(s)	149
MwoI	GCNNNNNNNGC	2 cut(s)	80, 92
NlaIII	CATG	2 cut(s)	55, 106
PkrI	GCNGC	1 cut(s)	85
RsaI	GTAC	1 cut(s)	192
RsaNI	GTAC	1 cut(s)	191
SaqAI	TTAA	1 cut(s)	150
SatI	GCNGC	1 cut(s)	84
ScaI	AGTACT	1 cut(s)	192
SetI	ASST	3 cut(s)	42, 127, 135
SfcI	CTRYAG	1 cut(s)	126
SmlI	CTYRAG	1 cut(s)	149
SmoI	CTYRAG	1 cut(s)	149
SspMI	CTAG	1 cut(s)	9
TaqI	TCGA	1 cut(s)	138
TatI	WGTACW	1 cut(s)	190
Tru1I	TTAA	1 cut(s)	150
Tru9I	TTAA	1 cut(s)	150
TseI	GCWGC	1 cut(s)	83
TspDTI	ATGAA	2 cut(s)	50, 186
Vha464I	CTTAAG	1 cut(s)	149
XcmI	CCANNNNNNNNNTGG	1 cut(s)	94
XspI	CTAG	1 cut(s)	9
ZrmI	AGTACT	1 cut(s)	192

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.