Rmu_sc0040950.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040950.1
Physical Location & Seq
Reverse (-)
2 .. 151
150 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040950.1_g000001.1.cds

Sequence Viewer

Length: 150 bp
atggaaggaaatgaggagcgagctctagagctttttgatgacatgcttaagcaagcggtgaaaccagatgaagtagtctttgtggcagtaccagcagtgtgtagccatgttggtcttccaggaacaagggcggaacgttttcatgtcaac

Protein Analysis

50

Amino Acids

5.55

Weight (kDa)

4.86

Isoelectric Point (pI)

24.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 56, 131
AclI AACGTT 1 cut(s) 136
AfaI GTAC 1 cut(s) 90
AflII CTTAAG 1 cut(s) 47
AjnI CCWGG 1 cut(s) 118
AluBI AGCT 2 cut(s) 23, 31
AluI AGCT 2 cut(s) 23, 31
Alw21I GWGCWC 1 cut(s) 25
Asp700I GAANNNNTTC 1 cut(s) 138
AsuHPI GGTGA 1 cut(s) 70
BanII GRGCYC 1 cut(s) 25
BbsI GAAGAC 1 cut(s) 107
Bbv12I GWGCWC 1 cut(s) 25
BciT130I CCWGG 1 cut(s) 120
BfaI CTAG 1 cut(s) 26
BfrI CTTAAG 1 cut(s) 47
Bme1390I CCNGG 1 cut(s) 120
BmrFI CCNGG 1 cut(s) 120
BpiI GAAGAC 1 cut(s) 107
BseBI CCWGG 1 cut(s) 120
BseRI GAGGAG 1 cut(s) 29
BsiHKAI GWGCWC 1 cut(s) 25
Bsp1286I GDGCHC 1 cut(s) 25
BspACI CCGC 2 cut(s) 56, 131
BspTI CTTAAG 1 cut(s) 47
Bst2UI CCWGG 1 cut(s) 120
BstAFI CTTAAG 1 cut(s) 47
BstC8I GCNNGC 2 cut(s) 21, 54
BstMWI GCNNNNNNNGC 1 cut(s) 92
BstNI CCWGG 1 cut(s) 120
BstNSI RCATGY 1 cut(s) 46
BstSCI CCNGG 1 cut(s) 118
BstV2I GAAGAC 1 cut(s) 107
BtsI GCAGTG 1 cut(s) 102
BtsIMutI CAGTG 1 cut(s) 102
Cac8I GCNNGC 2 cut(s) 21, 54
Csp6I GTAC 1 cut(s) 89
CviAII CATG 3 cut(s) 43, 107, 143
CviJI RGCY 3 cut(s) 23, 31, 105
CviKI_1 RGCY 3 cut(s) 23, 31, 105
CviQI GTAC 1 cut(s) 89
EciI GGCGGA 1 cut(s) 146
Ecl136II GAGCTC 1 cut(s) 23
Eco24I GRGCYC 1 cut(s) 25
Eco53kI GAGCTC 1 cut(s) 23
EcoICRI GAGCTC 1 cut(s) 23
EcoRII CCWGG 1 cut(s) 118
EcoT38I GRGCYC 1 cut(s) 25
FaeI CATG 3 cut(s) 46, 110, 146
FaiI YATR 3 cut(s) 44, 108, 144
FatI CATG 3 cut(s) 42, 106, 142
FriOI GRGCYC 1 cut(s) 25
FspBI CTAG 1 cut(s) 26
Hin1II CATG 3 cut(s) 46, 110, 146
HincII GTYRAC 1 cut(s) 148
HindII GTYRAC 1 cut(s) 148
HphI GGTGA 1 cut(s) 70
Hpy166II GTNNAC 1 cut(s) 148
Hpy188III TCNNGA 1 cut(s) 26
Hpy8I GTNNAC 1 cut(s) 148
HpyCH4IV ACGT 1 cut(s) 136
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
HpySE526I ACGT 1 cut(s) 136
Hsp92II CATG 3 cut(s) 46, 110, 146
LmnI GCTCC 1 cut(s) 16
LpnPI CCDG 4 cut(s) 78, 105, 105, 132
MaeI CTAG 1 cut(s) 26
MaeII ACGT 1 cut(s) 136
MboII GAAGA 1 cut(s) 107
MhlI GDGCHC 1 cut(s) 25
MnlI CCTC 1 cut(s) 7
MroXI GAANNNNTTC 1 cut(s) 138
MseI TTAA 1 cut(s) 48
MspCI CTTAAG 1 cut(s) 47
MspR9I CCNGG 1 cut(s) 120
MvaI CCWGG 1 cut(s) 120
MwoI GCNNNNNNNGC 1 cut(s) 92
NlaIII CATG 3 cut(s) 46, 110, 146
NspI RCATGY 1 cut(s) 46
PdmI GAANNNNTTC 1 cut(s) 138
PfoI TCCNGGA 1 cut(s) 118
Psp124BI GAGCTC 1 cut(s) 25
Psp1406I AACGTT 1 cut(s) 136
Psp6I CCWGG 1 cut(s) 118
PspGI CCWGG 1 cut(s) 118
RsaI GTAC 1 cut(s) 90
RsaNI GTAC 1 cut(s) 89
SacI GAGCTC 1 cut(s) 25
SaqAI TTAA 1 cut(s) 48
ScrFI CCNGG 1 cut(s) 120
SduI GDGCHC 1 cut(s) 25
SetI ASST 3 cut(s) 25, 33, 139
SmlI CTYRAG 1 cut(s) 47
SmoI CTYRAG 1 cut(s) 47
SsiI CCGC 2 cut(s) 56, 131
SspMI CTAG 1 cut(s) 26
SstI GAGCTC 1 cut(s) 25
StyD4I CCNGG 1 cut(s) 118
TaiI ACGT 1 cut(s) 139
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TscAI CASTG 1 cut(s) 102
TspDTI ATGAA 2 cut(s) 84, 131
TspRI CASTG 1 cut(s) 102
Vha464I CTTAAG 1 cut(s) 47
XbaI TCTAGA 1 cut(s) 25
XceI RCATGY 1 cut(s) 46
XmnI GAANNNNTTC 1 cut(s) 138
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.