Rmu_co8063796.1_g000001

Pleiotropic drug resistance protein 2-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8063796.1
Physical Location & Seq
Reverse (-)
1 .. 555
555 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8063796.1_g000001.1.cds

Sequence Viewer

Length: 237 bp
ctgtttaacgttcttttcatcgcatgcttgaccttcttagatcctctcggtgaaactaaaactttgattgagaatgatgacgctgaaagcaacaggaagcgacgaaccaatcctgaaggtattgacatgcaagtgagaaatgcacaaggaggtcaagccaaaagaggaatggtcttgcctttccagcccctttcacttgctttcaaccatgtgaattactatgtggatatgcctgct

Protein Analysis

79

Amino Acids

8.91

Weight (kDa)

5.68

Isoelectric Point (pI)

55.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 9
AclWI GGATC 1 cut(s) 35
AcuI CTGAAG 1 cut(s) 135
AgsI TTSAA 1 cut(s) 205
AlwI GGATC 1 cut(s) 35
AsuHPI GGTGA 1 cut(s) 62
Bsp143I GATC 1 cut(s) 40
BspPI GGATC 1 cut(s) 35
BssMI GATC 1 cut(s) 40
BstC8I GCNNGC 2 cut(s) 25, 234
BstDEI CTNAG 1 cut(s) 37
BstKTI GATC 1 cut(s) 43
BstMBI GATC 1 cut(s) 40
BstMWI GCNNNNNNNGC 1 cut(s) 184
BstNSI RCATGY 2 cut(s) 27, 130
BstX2I RGATCY 1 cut(s) 40
BstYI RGATCY 1 cut(s) 40
BtgZI GCGATG 1 cut(s) 4
Cac8I GCNNGC 2 cut(s) 25, 234
CseI GACGC 1 cut(s) 89
CviAII CATG 3 cut(s) 24, 127, 209
CviJI RGCY 2 cut(s) 158, 187
CviKI_1 RGCY 2 cut(s) 158, 187
DdeI CTNAG 1 cut(s) 37
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
Eco57I CTGAAG 1 cut(s) 135
FaeI CATG 3 cut(s) 27, 130, 212
FaiI YATR 5 cut(s) 25, 128, 210, 222, 230
FatI CATG 3 cut(s) 23, 126, 208
HgaI GACGC 1 cut(s) 89
Hin1II CATG 3 cut(s) 27, 130, 212
HphI GGTGA 1 cut(s) 62
Hpy188III TCNNGA 1 cut(s) 113
Hpy99I CGWCG 1 cut(s) 105
HpyAV CCTTC 2 cut(s) 43, 110
HpyCH4IV ACGT 1 cut(s) 9
HpyCH4V TGCA 2 cut(s) 130, 143
HpyF10VI GCNNNNNNNGC 1 cut(s) 184
HpyF3I CTNAG 1 cut(s) 37
HpySE526I ACGT 1 cut(s) 9
Hsp92II CATG 3 cut(s) 27, 130, 212
Kzo9I GATC 1 cut(s) 40
LpnPI CCDG 3 cut(s) 79, 126, 197
MaeII ACGT 1 cut(s) 9
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MflI RGATCY 1 cut(s) 40
MluCI AATT 1 cut(s) 214
MnlI CCTC 3 cut(s) 54, 143, 158
MseI TTAA 1 cut(s) 6
MslI CAYNNNNRTG 1 cut(s) 131
MwoI GCNNNNNNNGC 1 cut(s) 184
NdeII GATC 1 cut(s) 40
NlaIII CATG 3 cut(s) 27, 130, 212
NspI RCATGY 2 cut(s) 27, 130
PaeI GCATGC 1 cut(s) 27
Psp1406I AACGTT 1 cut(s) 9
PsuI RGATCY 1 cut(s) 40
RseI CAYNNNNRTG 1 cut(s) 131
SaqAI TTAA 1 cut(s) 6
Sau3AI GATC 1 cut(s) 40
SetI ASST 4 cut(s) 12, 35, 121, 154
SmiMI CAYNNNNRTG 1 cut(s) 131
SphI GCATGC 1 cut(s) 27
Sse9I AATT 1 cut(s) 214
TaiI ACGT 1 cut(s) 12
TasI AATT 1 cut(s) 214
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TspDTI ATGAA 1 cut(s) 7
XceI RCATGY 2 cut(s) 27, 130
XcmI CCANNNNNNNNNTGG 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.