Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8356055.1

Orthogroup ID

OG0003940

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 857

Gene Structure 856 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8356055.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 568 bp

atggacatcatcagctgtgaccttgaaaaagccggtcacagtttcaacagaaggggttcgttttggactgacgatggcagggctgttttctcagcatcttcagttggagaggacgatgaggacgctctcaaatgggcagctttgcagagacttcctacattcactcgtttgaaaaaaggtctgctcactactcctcaaggccatgccaacgaagtcgatgtgcatcaccttgagctgcaagaaaagaaagacttgatcgagaggctagtgggagttgctgaggaggatcatgagaaatttttgttgaggctcaagagccgaattgatagagttggaattagtcttcctacaattgaagttaggttcgagcatttgaaaattgcagctgaaactcatgttggaggcagggctctgccttctgtcttcaattattgtgttaatgtagtggagggtttcttgaattgcctgcacgttcttcctgaaaagaaggaacatttgtctatactgaaagatgtcagtgggatcatcaagccttgcaggatgacattgcttttgggtcctccaagtt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ABC2_membrane ABC_tran ABC_trans_N PDR_assoc

Protein Analysis

189

Amino Acids

21.18

Weight (kDa)

6.31

Isoelectric Point (pI)

32.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003940)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g29821 FvH4_c11g00010
malus_domestica	MD02G1041000.v1.1 MD08G1141000.v1.1
pyrus_communis	pycom05g17200 pycom14g01660
rosa_chinensis	RchiOBHm_Chr6g0286311
rosa_laevigata	RLG00000012581 RLG00000034948 RLG00000034949
rosa_multiflora	Rmu_co8063796.1_g000001 Rmu_co8130532.1_g000001 Rmu_co8356055.1_g000001 Rmu_co8362065.1_g000001 Rmu_co8518233.1_g000001 Rmu_sc0010154.1_g000003 Rmu_sc0024937.1_g000002 Rmu_sc0041504.1_g000001
rosa_roxburghii	Rroxscaffold_1G00042760 Rroxscaffold_7G00169260 Rroxscaffold_7G00182440
rosa_samantha	Rh2CG374800 Rh5BG371500 Rh5BG371800 Rh5BG372200 Rh5BG372300 Rh5BG372500 Rh5CG394100 Rh5CG394300 Rh6CG295300 Rh6CG408800 Rh6DG395700 Rh6DG396100 Rh7DG199400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	294, 530
AcsI	RAATTY	1 cut(s)	296
AcuI	CTGAAG	1 cut(s)	84
AgsI	TTSAA	7 cut(s)	26, 46, 172, 356, 376, 427, 460
AjuI	GAANNNNNNNTTGG	2 cut(s)	381, 413
AluBI	AGCT	4 cut(s)	15, 140, 235, 386
AluI	AGCT	4 cut(s)	15, 140, 235, 386
Alw26I	GTCTC	1 cut(s)	142
AlwI	GGATC	2 cut(s)	294, 530
AoxI	GGCC	1 cut(s)	199
ApeKI	GCWGC	3 cut(s)	137, 235, 383
ApoI	RAATTY	1 cut(s)	296
ArsI	GACNNNNNNTTYG	2 cut(s)	535, 567
Asp700I	GAANNNNTTC	1 cut(s)	55
AspS9I	GGNCC	1 cut(s)	557
AsuHPI	GGTGA	1 cut(s)	218
AvaII	GGWCC	1 cut(s)	557
BanII	GRGCYC	1 cut(s)	412
BbsI	GAAGAC	2 cut(s)	335, 415
BbvCI	CCTCAGC	1 cut(s)	279
BbvI	GCAGC	3 cut(s)	149, 222, 395
BccI	CCATC	1 cut(s)	68
BcoDI	GTCTC	1 cut(s)	142
BfaI	CTAG	1 cut(s)	266
BisI	GCNGC	3 cut(s)	138, 236, 384
BlsI	GCNGC	3 cut(s)	139, 237, 385
Bme18I	GGWCC	1 cut(s)	557
BmgT120I	GGNCC	1 cut(s)	557
BmiI	GGNNCC	1 cut(s)	558
BmsI	GCATC	2 cut(s)	104, 232
BpiI	GAAGAC	2 cut(s)	335, 415
Bpu10I	CCTNAGC	1 cut(s)	279
BpuEI	CTTGAG	3 cut(s)	180, 251, 296
BsaBI	GATNNNNATC	1 cut(s)	222
Bse118I	RCCGGY	1 cut(s)	32
Bse3DI	GCAATG	1 cut(s)	545
Bse8I	GATNNNNATC	1 cut(s)	222
BseGI	GGATG	1 cut(s)	546
BseJI	GATNNNNATC	1 cut(s)	222
BseMI	GCAATG	1 cut(s)	545
BseMII	CTCAG	2 cut(s)	105, 270
BseRI	GAGGAG	2 cut(s)	183, 296
BseXI	GCAGC	3 cut(s)	149, 222, 395
BsgI	GTGCAG	1 cut(s)	452
BshFI	GGCC	1 cut(s)	201
BsiSI	CCGG	1 cut(s)	33
BsmAI	GTCTC	1 cut(s)	142
BsnI	GGCC	1 cut(s)	201
Bsp1286I	GDGCHC	1 cut(s)	412
Bsp143I	GATC	3 cut(s)	255, 286, 522
BspANI	GGCC	1 cut(s)	201
BspCNI	CTCAG	2 cut(s)	104, 271
BspHI	TCATGA	1 cut(s)	289
BspLI	GGNNCC	1 cut(s)	558
BspPI	GGATC	2 cut(s)	294, 530
BsrDI	GCAATG	1 cut(s)	545
BsrFI	RCCGGY	1 cut(s)	32
BssAI	RCCGGY	1 cut(s)	32
BssMI	GATC	3 cut(s)	255, 286, 522
Bst4CI	ACNGT	1 cut(s)	41
BstC8I	GCNNGC	1 cut(s)	467
BstDEI	CTNAG	2 cut(s)	91, 279
BstF5I	GGATG	1 cut(s)	546
BstKTI	GATC	3 cut(s)	258, 289, 525
BstMAI	GTCTC	1 cut(s)	142
BstMBI	GATC	3 cut(s)	255, 286, 522
BstV1I	GCAGC	3 cut(s)	149, 222, 395
BstV2I	GAAGAC	2 cut(s)	335, 415
BsuRI	GGCC	1 cut(s)	201
BtsCI	GGATG	1 cut(s)	546
BtsIMutI	CAGTG	1 cut(s)	523
Cac8I	GCNNGC	1 cut(s)	467
CciI	TCATGA	1 cut(s)	289
Cfr10I	RCCGGY	1 cut(s)	32
Cfr13I	GGNCC	1 cut(s)	557
CseI	GACGC	1 cut(s)	131
CviAII	CATG	3 cut(s)	203, 290, 395
DdeI	CTNAG	2 cut(s)	91, 279
DpnI	GATC	3 cut(s)	257, 288, 524
DpnII	GATC	3 cut(s)	255, 286, 522
Eco24I	GRGCYC	1 cut(s)	412
Eco47I	GGWCC	1 cut(s)	557
Eco57I	CTGAAG	1 cut(s)	84
EcoO109I	RGGNCCY	1 cut(s)	557
EcoT38I	GRGCYC	1 cut(s)	412
FaeI	CATG	3 cut(s)	206, 293, 398
FaiI	YATR	4 cut(s)	204, 291, 396, 503
FalI	AAGNNNNNCTT	2 cut(s)	236, 268
FatI	CATG	3 cut(s)	202, 289, 394
Fnu4HI	GCNGC	3 cut(s)	138, 236, 384
FokI	GGATG	1 cut(s)	553
FriOI	GRGCYC	1 cut(s)	412
Fsp4HI	GCNGC	3 cut(s)	138, 236, 384
FspBI	CTAG	1 cut(s)	266
GluI	GCNGC	3 cut(s)	138, 236, 384
HaeIII	GGCC	1 cut(s)	201
HapII	CCGG	1 cut(s)	33
HgaI	GACGC	1 cut(s)	131
Hin1II	CATG	3 cut(s)	206, 293, 398
HpaII	CCGG	1 cut(s)	33
HphI	GGTGA	1 cut(s)	218
Hpy188III	TCNNGA	5 cut(s)	259, 290, 313, 457, 479
HpyAV	CCTTC	3 cut(s)	45, 426, 481
HpyCH4III	ACNGT	1 cut(s)	41
HpyCH4IV	ACGT	1 cut(s)	471
HpyCH4V	TGCA	6 cut(s)	145, 223, 238, 383, 469, 537
HpyF3I	CTNAG	2 cut(s)	91, 279
HpySE526I	ACGT	1 cut(s)	471
Hsp92II	CATG	3 cut(s)	206, 293, 398
Kzo9I	GATC	3 cut(s)	255, 286, 522
LpnPI	CCDG	6 cut(s)	46, 64, 391, 479, 492, 523
Lsp1109I	GCAGC	3 cut(s)	149, 222, 395
LweI	GCATC	2 cut(s)	104, 232
MaeI	CTAG	1 cut(s)	266
MaeII	ACGT	1 cut(s)	471
MaeIII	GTNAC	2 cut(s)	17, 35
MalI	GATC	3 cut(s)	257, 288, 524
MboI	GATC	3 cut(s)	255, 286, 522
MboII	GAAGA	4 cut(s)	90, 335, 415, 467
MfeI	CAATTG	1 cut(s)	351
MhlI	GDGCHC	1 cut(s)	412
MluCI	AATT	7 cut(s)	296, 321, 336, 351, 378, 427, 460
MmeI	TCCRAC	3 cut(s)	85, 313, 379
MnlI	CCTC	9 cut(s)	103, 112, 204, 255, 274, 277, 300, 395, 442
MroXI	GAANNNNTTC	1 cut(s)	55
MseI	TTAA	1 cut(s)	438
MspA1I	CMGCKG	2 cut(s)	15, 386
MspI	CCGG	1 cut(s)	33
MunI	CAATTG	1 cut(s)	351
NdeII	GATC	3 cut(s)	255, 286, 522
NlaIII	CATG	3 cut(s)	206, 293, 398
NlaIV	GGNNCC	1 cut(s)	558
NmuCI	GTSAC	2 cut(s)	17, 35
PagI	TCATGA	1 cut(s)	289
PdmI	GAANNNNTTC	1 cut(s)	55
PkrI	GCNGC	3 cut(s)	139, 237, 385
PpuMI	RGGWCCY	1 cut(s)	557
Psp5II	RGGWCCY	1 cut(s)	557
PspN4I	GGNNCC	1 cut(s)	558
PspPI	GGNCC	1 cut(s)	557
PspPPI	RGGWCCY	1 cut(s)	557
PvuII	CAGCTG	2 cut(s)	15, 386
SaqAI	TTAA	1 cut(s)	438
SatI	GCNGC	3 cut(s)	138, 236, 384
Sau3AI	GATC	3 cut(s)	255, 286, 522
Sau96I	GGNCC	1 cut(s)	557
SduI	GDGCHC	1 cut(s)	412
SetI	ASST	9 cut(s)	17, 24, 142, 181, 231, 237, 365, 388, 474
SfaNI	GCATC	2 cut(s)	104, 232
SinI	GGWCC	1 cut(s)	557
SmlI	CTYRAG	3 cut(s)	195, 230, 311
SmoI	CTYRAG	3 cut(s)	195, 230, 311
Sse9I	AATT	7 cut(s)	296, 321, 336, 351, 378, 427, 460
SspMI	CTAG	1 cut(s)	266
TaaI	ACNGT	1 cut(s)	41
TaiI	ACGT	1 cut(s)	474
TaqI	TCGA	3 cut(s)	216, 258, 366
TasI	AATT	7 cut(s)	296, 321, 336, 351, 378, 427, 460
Tru1I	TTAA	1 cut(s)	438
Tru9I	TTAA	1 cut(s)	438
TscAI	CASTG	1 cut(s)	523
TseFI	GTSAC	2 cut(s)	17, 35
TseI	GCWGC	3 cut(s)	137, 235, 383
Tsp45I	GTSAC	2 cut(s)	17, 35
TspRI	CASTG	1 cut(s)	523
VpaK11BI	GGWCC	1 cut(s)	557
XapI	RAATTY	1 cut(s)	296
XmnI	GAANNNNTTC	1 cut(s)	55
XspI	CTAG	1 cut(s)	266

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.