Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0041504.1

Orthogroup ID

OG0003940

Physical Location & Seq

Genomic Coordinates Forward (+)

3010 .. 3948

Gene Structure 939 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0041504.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 432 bp

atggagatcatcagctgtgaccttgaaaaagccggtcacagtttccaccgaagcggttcgttttggactgacaatggcagggcggttttctcaacatcttcagttggagaggacaacgaggacgatgaggaagctctcaaatgggaagctctgcagagacttcctactttcactcgtttgaaaaaggggttgctcactagtcctcaaggccctgccatcgaagttgacttgcatcacctggagctgcaagaaaggaaaggcttgattgagaggcttgtgggagtagtcgaagaggatcatgagaacttcttgttgaggttcaagaatcgaatcgatagaatgacactgctcttgggtcctccaagttctgggaagaccacgctcttgtcggctttggctggagagcttgataaggatctcaaggttaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ABC2_membrane ABC_tran ABC_trans_N PDR_assoc

Protein Analysis

143

Amino Acids

16.07

Weight (kDa)

5.38

Isoelectric Point (pI)

40.16

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003940)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g29821 FvH4_c11g00010
malus_domestica	MD02G1041000.v1.1 MD08G1141000.v1.1
pyrus_communis	pycom05g17200 pycom14g01660
rosa_chinensis	RchiOBHm_Chr6g0286311
rosa_laevigata	RLG00000012581 RLG00000034948 RLG00000034949
rosa_multiflora	Rmu_co8063796.1_g000001 Rmu_co8130532.1_g000001 Rmu_co8356055.1_g000001 Rmu_co8362065.1_g000001 Rmu_co8518233.1_g000001 Rmu_sc0010154.1_g000003 Rmu_sc0024937.1_g000002 Rmu_sc0041504.1_g000001
rosa_roxburghii	Rroxscaffold_1G00042760 Rroxscaffold_7G00169260 Rroxscaffold_7G00182440
rosa_samantha	Rh2CG374800 Rh5BG371500 Rh5BG371800 Rh5BG372200 Rh5BG372300 Rh5BG372500 Rh5CG394100 Rh5CG394300 Rh6CG295300 Rh6CG408800 Rh6DG395700 Rh6DG396100 Rh7DG199400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	368
AciI	CCGC	2 cut(s)	54, 83
AclWI	GGATC	2 cut(s)	303, 423
AcuI	CTGAAG	1 cut(s)	84
AfiI	CCNNNNNNNGG	1 cut(s)	368
AgsI	TTSAA	3 cut(s)	26, 181, 322
AhlI	ACTAGT	1 cut(s)	197
AjnI	CCWGG	1 cut(s)	237
AluBI	AGCT	5 cut(s)	15, 134, 149, 244, 406
AluI	AGCT	5 cut(s)	15, 134, 149, 244, 406
Alw26I	GTCTC	1 cut(s)	151
AlwI	GGATC	2 cut(s)	303, 423
AoxI	GGCC	1 cut(s)	208
ApeKI	GCWGC	1 cut(s)	244
Asp700I	GAANNNNTTC	1 cut(s)	55
AspS9I	GGNCC	2 cut(s)	209, 356
AsuHPI	GGTGA	1 cut(s)	227
AvaII	GGWCC	1 cut(s)	356
BbsI	GAAGAC	1 cut(s)	380
BbvI	GCAGC	1 cut(s)	231
BccI	CCATC	1 cut(s)	224
BciT130I	CCWGG	1 cut(s)	239
BcoDI	GTCTC	1 cut(s)	151
BcuI	ACTAGT	1 cut(s)	197
BfaI	CTAG	1 cut(s)	198
BfmI	CTRYAG	1 cut(s)	152
BisI	GCNGC	1 cut(s)	245
BlsI	GCNGC	1 cut(s)	246
Bme1390I	CCNGG	1 cut(s)	239
Bme18I	GGWCC	1 cut(s)	356
BmgT120I	GGNCC	2 cut(s)	209, 356
BmiI	GGNNCC	1 cut(s)	357
BmrFI	CCNGG	1 cut(s)	239
BmsI	GCATC	1 cut(s)	241
BpiI	GAAGAC	1 cut(s)	380
BpmI	CTGGAG	2 cut(s)	260, 420
BpuEI	CTTGAG	2 cut(s)	189, 404
Bsa29I	ATCGAT	1 cut(s)	333
BsaBI	GATNNNNATC	1 cut(s)	414
Bsc4I	CCNNNNNNNGG	1 cut(s)	368
Bse118I	RCCGGY	1 cut(s)	32
Bse8I	GATNNNNATC	1 cut(s)	414
BseBI	CCWGG	1 cut(s)	239
BseCI	ATCGAT	1 cut(s)	333
BseJI	GATNNNNATC	1 cut(s)	414
BseLI	CCNNNNNNNGG	1 cut(s)	368
BseXI	GCAGC	1 cut(s)	231
BshFI	GGCC	1 cut(s)	210
BshVI	ATCGAT	1 cut(s)	333
BsiSI	CCGG	1 cut(s)	33
BslI	CCNNNNNNNGG	1 cut(s)	368
BsmAI	GTCTC	1 cut(s)	151
BsnI	GGCC	1 cut(s)	210
Bsp143I	GATC	3 cut(s)	6, 295, 415
BspACI	CCGC	2 cut(s)	54, 83
BspANI	GGCC	1 cut(s)	210
BspDI	ATCGAT	1 cut(s)	333
BspHI	TCATGA	1 cut(s)	298
BspLI	GGNNCC	1 cut(s)	357
BspMAI	CTGCAG	1 cut(s)	156
BspPI	GGATC	2 cut(s)	303, 423
BsrFI	RCCGGY	1 cut(s)	32
BssAI	RCCGGY	1 cut(s)	32
BssMI	GATC	3 cut(s)	6, 295, 415
Bst2UI	CCWGG	1 cut(s)	239
Bst4CI	ACNGT	1 cut(s)	41
Bst6I	CTCTTC	1 cut(s)	285
BstKTI	GATC	3 cut(s)	9, 298, 418
BstMAI	GTCTC	1 cut(s)	151
BstMBI	GATC	3 cut(s)	6, 295, 415
BstNI	CCWGG	1 cut(s)	239
BstSCI	CCNGG	1 cut(s)	237
BstSFI	CTRYAG	1 cut(s)	152
BstV1I	GCAGC	1 cut(s)	231
BstV2I	GAAGAC	1 cut(s)	380
BstX2I	RGATCY	1 cut(s)	415
BstYI	RGATCY	1 cut(s)	415
Bsu15I	ATCGAT	1 cut(s)	333
BsuRI	GGCC	1 cut(s)	210
BsuTUI	ATCGAT	1 cut(s)	333
BtsI	GCAGTG	1 cut(s)	344
BtsIMutI	CAGTG	1 cut(s)	344
CciI	TCATGA	1 cut(s)	298
Cfr10I	RCCGGY	1 cut(s)	32
Cfr13I	GGNCC	2 cut(s)	209, 356
ClaI	ATCGAT	1 cut(s)	333
CviAII	CATG	1 cut(s)	299
DpnI	GATC	3 cut(s)	8, 297, 417
DpnII	GATC	3 cut(s)	6, 295, 415
Eam1104I	CTCTTC	1 cut(s)	285
EarI	CTCTTC	1 cut(s)	285
Eco47I	GGWCC	1 cut(s)	356
Eco57I	CTGAAG	1 cut(s)	84
EcoO109I	RGGNCCY	2 cut(s)	209, 356
EcoRII	CCWGG	1 cut(s)	237
FaeI	CATG	1 cut(s)	302
FaiI	YATR	1 cut(s)	300
FatI	CATG	1 cut(s)	298
Fnu4HI	GCNGC	1 cut(s)	245
Fsp4HI	GCNGC	1 cut(s)	245
FspBI	CTAG	1 cut(s)	198
GluI	GCNGC	1 cut(s)	245
GsuI	CTGGAG	2 cut(s)	260, 420
HaeIII	GGCC	1 cut(s)	210
HapII	CCGG	1 cut(s)	33
Hin1II	CATG	1 cut(s)	302
HincII	GTYRAC	1 cut(s)	226
HindII	GTYRAC	1 cut(s)	226
HinfI	GANTC	2 cut(s)	325, 330
HpaII	CCGG	1 cut(s)	33
HphI	GGTGA	1 cut(s)	227
Hpy166II	GTNNAC	1 cut(s)	226
Hpy188III	TCNNGA	2 cut(s)	299, 322
Hpy8I	GTNNAC	1 cut(s)	226
HpyCH4III	ACNGT	1 cut(s)	41
HpyCH4V	TGCA	3 cut(s)	154, 232, 247
Hsp92II	CATG	1 cut(s)	302
Kzo9I	GATC	3 cut(s)	6, 295, 415
LmnI	GCTCC	1 cut(s)	241
LpnPI	CCDG	7 cut(s)	46, 64, 224, 225, 251, 354, 384
Lsp1109I	GCAGC	1 cut(s)	231
LweI	GCATC	1 cut(s)	241
MaeI	CTAG	1 cut(s)	198
MaeIII	GTNAC	2 cut(s)	17, 35
MalI	GATC	3 cut(s)	8, 297, 417
MboI	GATC	3 cut(s)	6, 295, 415
MboII	GAAGA	3 cut(s)	90, 302, 385
MflI	RGATCY	1 cut(s)	415
MmeI	TCCRAC	1 cut(s)	85
MnlI	CCTC	8 cut(s)	103, 112, 121, 213, 264, 286, 309, 369
MroXI	GAANNNNTTC	1 cut(s)	55
MseI	TTAA	1 cut(s)	426
MspA1I	CMGCKG	1 cut(s)	15
MspI	CCGG	1 cut(s)	33
MspR9I	CCNGG	1 cut(s)	239
MvaI	CCWGG	1 cut(s)	239
NdeII	GATC	3 cut(s)	6, 295, 415
NlaIII	CATG	1 cut(s)	302
NlaIV	GGNNCC	1 cut(s)	357
NmuCI	GTSAC	2 cut(s)	17, 35
PagI	TCATGA	1 cut(s)	298
PdmI	GAANNNNTTC	1 cut(s)	55
PfeI	GAWTC	2 cut(s)	325, 330
PflMI	CCANNNNNTGG	1 cut(s)	368
PkrI	GCNGC	1 cut(s)	246
PpuMI	RGGWCCY	1 cut(s)	356
Psp5II	RGGWCCY	1 cut(s)	356
Psp6I	CCWGG	1 cut(s)	237
PspGI	CCWGG	1 cut(s)	237
PspN4I	GGNNCC	1 cut(s)	357
PspPI	GGNCC	2 cut(s)	209, 356
PspPPI	RGGWCCY	1 cut(s)	356
PstI	CTGCAG	1 cut(s)	156
PsuI	RGATCY	1 cut(s)	415
PvuII	CAGCTG	1 cut(s)	15
SaqAI	TTAA	1 cut(s)	426
SatI	GCNGC	1 cut(s)	245
Sau3AI	GATC	3 cut(s)	6, 295, 415
Sau96I	GGNCC	2 cut(s)	209, 356
ScrFI	CCNGG	1 cut(s)	239
SetI	ASST	9 cut(s)	17, 24, 136, 151, 240, 246, 320, 408, 426
SfaNI	GCATC	1 cut(s)	241
SfcI	CTRYAG	1 cut(s)	152
SinI	GGWCC	1 cut(s)	356
SmlI	CTYRAG	2 cut(s)	204, 419
SmoI	CTYRAG	2 cut(s)	204, 419
SpeI	ACTAGT	1 cut(s)	197
SsiI	CCGC	2 cut(s)	54, 83
SspMI	CTAG	1 cut(s)	198
StyD4I	CCNGG	1 cut(s)	237
TaaI	ACNGT	1 cut(s)	41
TaqI	TCGA	4 cut(s)	219, 288, 328, 333
TfiI	GAWTC	2 cut(s)	325, 330
Tru1I	TTAA	1 cut(s)	426
Tru9I	TTAA	1 cut(s)	426
TscAI	CASTG	1 cut(s)	351
TseFI	GTSAC	2 cut(s)	17, 35
TseI	GCWGC	1 cut(s)	244
Tsp45I	GTSAC	2 cut(s)	17, 35
TspRI	CASTG	1 cut(s)	351
Van91I	CCANNNNNTGG	1 cut(s)	368
VpaK11BI	GGWCC	1 cut(s)	356
XmnI	GAANNNNTTC	1 cut(s)	55
XspI	CTAG	1 cut(s)	198

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.