Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0024937.1

Orthogroup ID

OG0003940

Physical Location & Seq

Genomic Coordinates Reverse (-)

1187 .. 3633

Gene Structure 2447 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0024937.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 702 bp

ctgcaagaaaagaaagacttgatcgggaggctagtgggagttgctgaggaggatcatgagaaatttttgttaaagctcaagagccgaatcgatagagttggaattagtcttcctacaattgaagtcaggttcgagcatctgaaaattgcagctgaaactcatgttggaggcatggctctgctttctgtcttcaattgttgtgttaatgtattggaggattctgtcgttatcttcctagcatcaccgtccgtcccagaacgatcagtgcatcttcttcttggacgtcgttcagacaggcctcgtctccccatactgccttcgtcttcctccagctctaaagatcagcctgtccagccagctacagtgctcgaccgtgccccgagacccgttcatatcacaccagatcgtgtatcgatcaattctcgatgtcgctgccgtctgcttcactttgctgccctgcccagactgatgtcgctcctcgtcgtcgatcaggttcttcagttcgcagcccgtcgcaactctgcccagaccgtcatcgcttctcatcactctccaaagatcgaccagattctgcacttcgtcgaccagacctcaactcggttaactcgcctcaactcgatctcccagtcaactcgcctcaactcggtcaacttcagtcagcctcactcggtcaacccgttcagaccagtcaataggttataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ABC2_membrane ABC_tran ABC_trans_N PDR_assoc

Protein Analysis

233

Amino Acids

26.07

Weight (kDa)

10.38

Isoelectric Point (pI)

54.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003940)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g29821 FvH4_c11g00010
malus_domestica	MD02G1041000.v1.1 MD08G1141000.v1.1
pyrus_communis	pycom05g17200 pycom14g01660
rosa_chinensis	RchiOBHm_Chr6g0286311
rosa_laevigata	RLG00000012581 RLG00000034948 RLG00000034949
rosa_multiflora	Rmu_co8063796.1_g000001 Rmu_co8130532.1_g000001 Rmu_co8356055.1_g000001 Rmu_co8362065.1_g000001 Rmu_co8518233.1_g000001 Rmu_sc0010154.1_g000003 Rmu_sc0024937.1_g000002 Rmu_sc0041504.1_g000001
rosa_roxburghii	Rroxscaffold_1G00042760 Rroxscaffold_7G00169260 Rroxscaffold_7G00182440
rosa_samantha	Rh2CG374800 Rh5BG371500 Rh5BG371800 Rh5BG372200 Rh5BG372300 Rh5BG372500 Rh5CG394100 Rh5CG394300 Rh6CG295300 Rh6CG408800 Rh6DG395700 Rh6DG396100 Rh7DG199400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	700
AatII	GACGTC	1 cut(s)	286
AccI	GTMKAC	1 cut(s)	582
AclWI	GGATC	1 cut(s)	60
AcsI	RAATTY	1 cut(s)	62
AcuI	CTGAAG	2 cut(s)	482, 637
AcyI	GRCGYC	1 cut(s)	283
AfiI	CCNNNNNNNGG	2 cut(s)	597, 643
AgsI	TTSAA	2 cut(s)	122, 193
AjuI	GAANNNNNNNTTGG	2 cut(s)	147, 179
AluBI	AGCT	4 cut(s)	76, 152, 333, 359
AluI	AGCT	4 cut(s)	76, 152, 333, 359
Alw21I	GWGCWC	1 cut(s)	369
Alw26I	GTCTC	2 cut(s)	308, 376
AlwI	GGATC	1 cut(s)	60
AlwNI	CAGNNNCTG	1 cut(s)	571
Ama87I	CYCGRG	1 cut(s)	379
AoxI	GGCC	1 cut(s)	296
ApeKI	GCWGC	4 cut(s)	149, 432, 452, 506
ApoI	RAATTY	1 cut(s)	62
AsuHPI	GGTGA	1 cut(s)	234
AvaI	CYCGRG	1 cut(s)	379
BaeGI	GKGCMC	1 cut(s)	379
BbsI	GAAGAC	3 cut(s)	101, 181, 315
Bbv12I	GWGCWC	1 cut(s)	369
BbvCI	CCTCAGC	1 cut(s)	45
BbvI	GCAGC	4 cut(s)	161, 419, 439, 518
BceAI	ACGGC	1 cut(s)	420
BcgI	CGANNNNNNTGC	2 cut(s)	414, 448
BcoDI	GTCTC	2 cut(s)	308, 376
BfaI	CTAG	2 cut(s)	32, 236
BfmI	CTRYAG	1 cut(s)	360
BisI	GCNGC	4 cut(s)	150, 433, 453, 507
BlsI	GCNGC	4 cut(s)	151, 434, 454, 508
BmeT110I	CYCGRG	1 cut(s)	379
BmrI	ACTGGG	1 cut(s)	619
BmsI	GCATC	3 cut(s)	145, 248, 277
BmuI	ACTGGG	1 cut(s)	619
BoxI	GACNNNNGTC	1 cut(s)	469
BpiI	GAAGAC	3 cut(s)	101, 181, 315
BpmI	CTGGAG	1 cut(s)	313
Bpu10I	CCTNAGC	1 cut(s)	45
BpuEI	CTTGAG	1 cut(s)	62
Bsa29I	ATCGAT	2 cut(s)	90, 413
BsaHI	GRCGYC	1 cut(s)	283
BsaI	GGTCTC	1 cut(s)	376
BsaXI	ACNNNNNCTCC	2 cut(s)	605, 635
Bsc4I	CCNNNNNNNGG	2 cut(s)	597, 643
Bse1I	ACTGG	2 cut(s)	625, 686
BseCI	ATCGAT	2 cut(s)	90, 413
BseLI	CCNNNNNNNGG	2 cut(s)	597, 643
BseMII	CTCAG	1 cut(s)	36
BseNI	ACTGG	2 cut(s)	625, 686
BseRI	GAGGAG	2 cut(s)	62, 467
BseSI	GKGCMC	1 cut(s)	379
BseXI	GCAGC	4 cut(s)	161, 419, 439, 518
BsgI	GTGCAG	1 cut(s)	557
Bsh1285I	CGRYCG	1 cut(s)	373
BshFI	GGCC	1 cut(s)	298
BshVI	ATCGAT	2 cut(s)	90, 413
BsiEI	CGRYCG	1 cut(s)	373
BsiHKAI	GWGCWC	1 cut(s)	369
BsiHKCI	CYCGRG	1 cut(s)	379
BslFI	GGGAC	1 cut(s)	236
BslI	CCNNNNNNNGG	2 cut(s)	597, 643
BsmAI	GTCTC	2 cut(s)	308, 376
BsmBI	CGTCTC	1 cut(s)	308
BsmFI	GGGAC	1 cut(s)	236
BsnI	GGCC	1 cut(s)	298
Bso31I	GGTCTC	1 cut(s)	376
BsoBI	CYCGRG	1 cut(s)	379
Bsp1286I	GDGCHC	2 cut(s)	369, 379
Bsp143I	GATC	9 cut(s)	21, 52, 260, 340, 403, 414, 487, 558, 618
BspANI	GGCC	1 cut(s)	298
BspCNI	CTCAG	1 cut(s)	37
BspDI	ATCGAT	2 cut(s)	90, 413
BspHI	TCATGA	1 cut(s)	55
BspPI	GGATC	1 cut(s)	60
BspTNI	GGTCTC	1 cut(s)	376
BsrI	ACTGG	2 cut(s)	625, 686
BssMI	GATC	9 cut(s)	21, 52, 260, 340, 403, 414, 487, 558, 618
BssNI	GRCGYC	1 cut(s)	283
Bst4CI	ACNGT	4 cut(s)	246, 364, 374, 532
BstACI	GRCGYC	1 cut(s)	283
BstC8I	GCNNGC	1 cut(s)	357
BstDEI	CTNAG	1 cut(s)	45
BstKTI	GATC	9 cut(s)	24, 55, 263, 343, 406, 417, 490, 561, 621
BstMAI	GTCTC	2 cut(s)	308, 376
BstMBI	GATC	9 cut(s)	21, 52, 260, 340, 403, 414, 487, 558, 618
BstMCI	CGRYCG	1 cut(s)	373
BstMWI	GCNNNNNNNGC	1 cut(s)	352
BstPAI	GACNNNNGTC	1 cut(s)	469
BstSFI	CTRYAG	1 cut(s)	360
BstSLI	GKGCMC	1 cut(s)	379
BstV1I	GCAGC	4 cut(s)	161, 419, 439, 518
BstV2I	GAAGAC	3 cut(s)	101, 181, 315
Bsu15I	ATCGAT	2 cut(s)	90, 413
BsuRI	GGCC	1 cut(s)	298
BsuTUI	ATCGAT	2 cut(s)	90, 413
BtgZI	GCGATG	1 cut(s)	520
BtsIMutI	CAGTG	2 cut(s)	270, 369
Cac8I	GCNNGC	1 cut(s)	357
CaiI	CAGNNNCTG	1 cut(s)	571
CciI	TCATGA	1 cut(s)	55
ClaI	ATCGAT	2 cut(s)	90, 413
CviAII	CATG	3 cut(s)	56, 161, 172
DdeI	CTNAG	1 cut(s)	45
DpnI	GATC	9 cut(s)	23, 54, 262, 342, 405, 416, 489, 560, 620
DpnII	GATC	9 cut(s)	21, 52, 260, 340, 403, 414, 487, 558, 618
Eco147I	AGGCCT	1 cut(s)	298
Eco31I	GGTCTC	1 cut(s)	376
Eco57I	CTGAAG	2 cut(s)	482, 637
Eco88I	CYCGRG	1 cut(s)	379
Esp3I	CGTCTC	1 cut(s)	308
FaeI	CATG	3 cut(s)	59, 164, 175
FaiI	YATR	6 cut(s)	57, 162, 173, 311, 393, 700
FalI	AAGNNNNNCTT	1 cut(s)	34
FaqI	GGGAC	1 cut(s)	236
FatI	CATG	3 cut(s)	55, 160, 171
FblI	GTMKAC	1 cut(s)	582
Fnu4HI	GCNGC	4 cut(s)	150, 433, 453, 507
Fsp4HI	GCNGC	4 cut(s)	150, 433, 453, 507
FspBI	CTAG	2 cut(s)	32, 236
GluI	GCNGC	4 cut(s)	150, 433, 453, 507
GsuI	CTGGAG	1 cut(s)	313
HaeIII	GGCC	1 cut(s)	298
Hin1I	GRCGYC	1 cut(s)	283
Hin1II	CATG	3 cut(s)	59, 164, 175
HincII	GTYRAC	5 cut(s)	583, 603, 630, 649, 673
HindII	GTYRAC	5 cut(s)	583, 603, 630, 649, 673
HinfI	GANTC	3 cut(s)	87, 218, 568
HpaI	GTTAAC	1 cut(s)	603
HphI	GGTGA	1 cut(s)	234
Hpy166II	GTNNAC	5 cut(s)	583, 603, 630, 649, 673
Hpy188I	TCNGA	3 cut(s)	141, 292, 683
Hpy188III	TCNNGA	4 cut(s)	25, 56, 79, 423
Hpy8I	GTNNAC	5 cut(s)	583, 603, 630, 649, 673
Hpy99I	CGWCG	5 cut(s)	288, 485, 488, 516, 584
HpyAV	CCTTC	1 cut(s)	327
HpyCH4III	ACNGT	4 cut(s)	246, 364, 374, 532
HpyCH4IV	ACGT	1 cut(s)	283
HpyCH4V	TGCA	4 cut(s)	4, 149, 268, 574
HpyF10VI	GCNNNNNNNGC	1 cut(s)	352
HpyF3I	CTNAG	1 cut(s)	45
HpySE526I	ACGT	1 cut(s)	283
Hsp92I	GRCGYC	1 cut(s)	283
Hsp92II	CATG	3 cut(s)	59, 164, 175
KspAI	GTTAAC	1 cut(s)	603
Kzo9I	GATC	9 cut(s)	21, 52, 260, 340, 403, 414, 487, 558, 618
LmnI	GCTCC	1 cut(s)	480
Lsp1109I	GCAGC	4 cut(s)	161, 419, 439, 518
LweI	GCATC	3 cut(s)	145, 248, 277
MaeI	CTAG	2 cut(s)	32, 236
MaeII	ACGT	1 cut(s)	283
MalI	GATC	9 cut(s)	23, 54, 262, 342, 405, 416, 489, 560, 620
MboI	GATC	9 cut(s)	21, 52, 260, 340, 403, 414, 487, 558, 618
MboII	GAAGA	7 cut(s)	101, 181, 223, 263, 266, 315, 488
MfeI	CAATTG	2 cut(s)	117, 193
MhlI	GDGCHC	2 cut(s)	369, 379
MluCI	AATT	6 cut(s)	62, 102, 117, 144, 193, 418
MmeI	TCCRAC	2 cut(s)	79, 145
MseI	TTAA	3 cut(s)	71, 204, 602
MspA1I	CMGCKG	1 cut(s)	152
MunI	CAATTG	2 cut(s)	117, 193
MwoI	GCNNNNNNNGC	1 cut(s)	352
NdeII	GATC	9 cut(s)	21, 52, 260, 340, 403, 414, 487, 558, 618
NlaIII	CATG	3 cut(s)	59, 164, 175
PagI	TCATGA	1 cut(s)	55
PceI	AGGCCT	1 cut(s)	298
PcsI	WCGNNNNNNNCGW	1 cut(s)	674
PfeI	GAWTC	3 cut(s)	87, 218, 568
PkrI	GCNGC	4 cut(s)	151, 434, 454, 508
PshAI	GACNNNNGTC	1 cut(s)	469
PsiI	TTATAA	1 cut(s)	700
PstNI	CAGNNNCTG	1 cut(s)	571
PvuII	CAGCTG	1 cut(s)	152
SalI	GTCGAC	1 cut(s)	581
SaqAI	TTAA	3 cut(s)	71, 204, 602
SatI	GCNGC	4 cut(s)	150, 433, 453, 507
Sau3AI	GATC	9 cut(s)	21, 52, 260, 340, 403, 414, 487, 558, 618
SduI	GDGCHC	2 cut(s)	369, 379
SetI	ASST	9 cut(s)	78, 131, 154, 286, 335, 361, 495, 593, 698
SfaNI	GCATC	3 cut(s)	145, 248, 277
SfcI	CTRYAG	1 cut(s)	360
SmlI	CTYRAG	1 cut(s)	77
SmoI	CTYRAG	1 cut(s)	77
Sse9I	AATT	6 cut(s)	62, 102, 117, 144, 193, 418
SseBI	AGGCCT	1 cut(s)	298
SspMI	CTAG	2 cut(s)	32, 236
StuI	AGGCCT	1 cut(s)	298
TaaI	ACNGT	4 cut(s)	246, 364, 374, 532
TaiI	ACGT	1 cut(s)	286
TaqI	TCGA	9 cut(s)	90, 132, 369, 413, 424, 486, 561, 582, 617
TaqII	GACCGA	2 cut(s)	634, 658
TasI	AATT	6 cut(s)	62, 102, 117, 144, 193, 418
TfiI	GAWTC	3 cut(s)	87, 218, 568
Tru1I	TTAA	3 cut(s)	71, 204, 602
Tru9I	TTAA	3 cut(s)	71, 204, 602
TscAI	CASTG	2 cut(s)	270, 369
TseI	GCWGC	4 cut(s)	149, 432, 452, 506
TspDTI	ATGAA	1 cut(s)	380
TspGWI	ACGGA	1 cut(s)	238
TspRI	CASTG	2 cut(s)	270, 369
XapI	RAATTY	1 cut(s)	62
XmiI	GTMKAC	1 cut(s)	582
XspI	CTAG	2 cut(s)	32, 236
ZraI	GACGTC	1 cut(s)	284

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.