Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8362065.1

Orthogroup ID

OG0003940

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 429

Gene Structure 429 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8362065.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 330 bp

accttcactcgtttgaaaaaagggttgctcactactccacaaggccatgccaacgaagttgatgtgcatcaccttgagctgcaagaaaagaaagacttgatcgggaggctagtgggagttgctgaggaggatcatgagaaatttttgttaaagctcaagagccgaatcgatagagttggaattagtcttcctacaattgaagtcaggttcgagcatctgaaaattgcagctgaaactcatgttggaggcatggctctgctttctgtcttcaattgttgtgttaatgtattggaggtactaatagagtaccacatttcaagttttgggtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ABC2_membrane ABC_tran ABC_trans_N PDR_assoc

Protein Analysis

109

Amino Acids

12.24

Weight (kDa)

6.35

Isoelectric Point (pI)

30.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003940)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g29821 FvH4_c11g00010
malus_domestica	MD02G1041000.v1.1 MD08G1141000.v1.1
pyrus_communis	pycom05g17200 pycom14g01660
rosa_chinensis	RchiOBHm_Chr6g0286311
rosa_laevigata	RLG00000012581 RLG00000034948 RLG00000034949
rosa_multiflora	Rmu_co8063796.1_g000001 Rmu_co8130532.1_g000001 Rmu_co8356055.1_g000001 Rmu_co8362065.1_g000001 Rmu_co8518233.1_g000001 Rmu_sc0010154.1_g000003 Rmu_sc0024937.1_g000002 Rmu_sc0041504.1_g000001
rosa_roxburghii	Rroxscaffold_1G00042760 Rroxscaffold_7G00169260 Rroxscaffold_7G00182440
rosa_samantha	Rh2CG374800 Rh5BG371500 Rh5BG371800 Rh5BG372200 Rh5BG372300 Rh5BG372500 Rh5CG394100 Rh5CG394300 Rh6CG295300 Rh6CG408800 Rh6DG395700 Rh6DG396100 Rh7DG199400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	138
AcsI	RAATTY	1 cut(s)	140
AfaI	GTAC	2 cut(s)	297, 308
AgsI	TTSAA	4 cut(s)	16, 200, 271, 318
AjuI	GAANNNNNNNTTGG	2 cut(s)	225, 257
AluBI	AGCT	3 cut(s)	79, 154, 230
AluI	AGCT	3 cut(s)	79, 154, 230
AlwI	GGATC	1 cut(s)	138
AoxI	GGCC	1 cut(s)	43
ApeKI	GCWGC	2 cut(s)	79, 227
ApoI	RAATTY	1 cut(s)	140
AsuHPI	GGTGA	1 cut(s)	62
BbsI	GAAGAC	2 cut(s)	179, 259
BbvCI	CCTCAGC	1 cut(s)	123
BbvI	GCAGC	2 cut(s)	66, 239
BfaI	CTAG	1 cut(s)	110
BisI	GCNGC	2 cut(s)	80, 228
BlsI	GCNGC	2 cut(s)	81, 229
BmsI	GCATC	2 cut(s)	76, 223
BpiI	GAAGAC	2 cut(s)	179, 259
Bpu10I	CCTNAGC	1 cut(s)	123
BpuEI	CTTGAG	2 cut(s)	95, 140
Bsa29I	ATCGAT	1 cut(s)	168
BsaBI	GATNNNNATC	1 cut(s)	66
Bse8I	GATNNNNATC	1 cut(s)	66
BseCI	ATCGAT	1 cut(s)	168
BseJI	GATNNNNATC	1 cut(s)	66
BseMII	CTCAG	1 cut(s)	114
BseRI	GAGGAG	1 cut(s)	140
BseXI	GCAGC	2 cut(s)	66, 239
BshFI	GGCC	1 cut(s)	45
BshVI	ATCGAT	1 cut(s)	168
BsnI	GGCC	1 cut(s)	45
Bsp143I	GATC	2 cut(s)	99, 130
BspANI	GGCC	1 cut(s)	45
BspCNI	CTCAG	1 cut(s)	115
BspDI	ATCGAT	1 cut(s)	168
BspHI	TCATGA	1 cut(s)	133
BspPI	GGATC	1 cut(s)	138
BssMI	GATC	2 cut(s)	99, 130
BstDEI	CTNAG	1 cut(s)	123
BstKTI	GATC	2 cut(s)	102, 133
BstMBI	GATC	2 cut(s)	99, 130
BstV1I	GCAGC	2 cut(s)	66, 239
BstV2I	GAAGAC	2 cut(s)	179, 259
Bsu15I	ATCGAT	1 cut(s)	168
BsuRI	GGCC	1 cut(s)	45
BsuTUI	ATCGAT	1 cut(s)	168
CciI	TCATGA	1 cut(s)	133
ClaI	ATCGAT	1 cut(s)	168
Csp6I	GTAC	2 cut(s)	296, 307
CviAII	CATG	4 cut(s)	47, 134, 239, 250
CviJI	RGCY	7 cut(s)	45, 79, 109, 154, 162, 230, 254
CviKI_1	RGCY	7 cut(s)	45, 79, 109, 154, 162, 230, 254
CviQI	GTAC	2 cut(s)	296, 307
DdeI	CTNAG	1 cut(s)	123
DpnI	GATC	2 cut(s)	101, 132
DpnII	GATC	2 cut(s)	99, 130
FaeI	CATG	4 cut(s)	50, 137, 242, 253
FaiI	YATR	4 cut(s)	48, 135, 240, 251
FalI	AAGNNNNNCTT	2 cut(s)	80, 112
FatI	CATG	4 cut(s)	46, 133, 238, 249
Fnu4HI	GCNGC	2 cut(s)	80, 228
Fsp4HI	GCNGC	2 cut(s)	80, 228
FspBI	CTAG	1 cut(s)	110
GluI	GCNGC	2 cut(s)	80, 228
HaeIII	GGCC	1 cut(s)	45
Hin1II	CATG	4 cut(s)	50, 137, 242, 253
HinfI	GANTC	1 cut(s)	165
HphI	GGTGA	1 cut(s)	62
Hpy188I	TCNGA	1 cut(s)	219
Hpy188III	TCNNGA	3 cut(s)	103, 134, 157
HpyAV	CCTTC	1 cut(s)	13
HpyCH4V	TGCA	3 cut(s)	67, 82, 227
HpyF3I	CTNAG	1 cut(s)	123
Hsp92II	CATG	4 cut(s)	50, 137, 242, 253
Kzo9I	GATC	2 cut(s)	99, 130
LpnPI	CCDG	1 cut(s)	190
Lsp1109I	GCAGC	2 cut(s)	66, 239
LweI	GCATC	2 cut(s)	76, 223
MaeI	CTAG	1 cut(s)	110
MalI	GATC	2 cut(s)	101, 132
MboI	GATC	2 cut(s)	99, 130
MboII	GAAGA	2 cut(s)	179, 259
MfeI	CAATTG	2 cut(s)	195, 271
MluCI	AATT	5 cut(s)	140, 180, 195, 222, 271
MmeI	TCCRAC	2 cut(s)	157, 223
MnlI	CCTC	5 cut(s)	99, 118, 121, 239, 286
MseI	TTAA	2 cut(s)	149, 282
MspA1I	CMGCKG	1 cut(s)	230
MunI	CAATTG	2 cut(s)	195, 271
NdeII	GATC	2 cut(s)	99, 130
NlaIII	CATG	4 cut(s)	50, 137, 242, 253
PagI	TCATGA	1 cut(s)	133
PfeI	GAWTC	1 cut(s)	165
PkrI	GCNGC	2 cut(s)	81, 229
PvuII	CAGCTG	1 cut(s)	230
RsaI	GTAC	2 cut(s)	297, 308
RsaNI	GTAC	2 cut(s)	296, 307
SaqAI	TTAA	2 cut(s)	149, 282
SatI	GCNGC	2 cut(s)	80, 228
Sau3AI	GATC	2 cut(s)	99, 130
SetI	ASST	6 cut(s)	75, 81, 156, 209, 232, 297
SfaNI	GCATC	2 cut(s)	76, 223
SmlI	CTYRAG	2 cut(s)	74, 155
SmoI	CTYRAG	2 cut(s)	74, 155
Sse9I	AATT	5 cut(s)	140, 180, 195, 222, 271
SspMI	CTAG	1 cut(s)	110
TaqI	TCGA	2 cut(s)	168, 210
TasI	AATT	5 cut(s)	140, 180, 195, 222, 271
TfiI	GAWTC	1 cut(s)	165
Tru1I	TTAA	2 cut(s)	149, 282
Tru9I	TTAA	2 cut(s)	149, 282
TseI	GCWGC	2 cut(s)	79, 227
XapI	RAATTY	1 cut(s)	140
XspI	CTAG	1 cut(s)	110

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.