Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8087500.1

Orthogroup ID

OG0000713

Physical Location & Seq

Genomic Coordinates Reverse (-)

8 .. 478

Gene Structure 471 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8087500.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 471 bp

atgtatggatgggaacttgacaaggactctcaagacaaggagggctttgcaatagcagccacgatgccaaaactcaagcaccttgagttacgctttatgcgtattagtacagaacctgtgcttcagatactattgaactgtcctgagctccatttgttaaacgtgctagggtgctacagtgtaaaaattgacgaaaagtttgtcaagaagttcccagggctgaatgtggttggaccaggttcaggcaatgagggttgggatgattgctccactttctcagtttcttccagctacttagattgggacttgatgggctgcgtaatcaacaatgatgactatgaggtagagtatgattattttgatgaagatgaggcctgggaagacgatcaaagtatggcggatgtagaatttagcttctatgatggtttttatcttgataatgctgggtttgattggcccccaactccttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box F-box-like

Protein Analysis

156

Amino Acids

17.9

Weight (kDa)

4.05

Isoelectric Point (pI)

43.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000713)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G08980 AT4G08980 AT4G08980 AT4G08980 AT4G08980
fragaria_vesca	FvH4_1g20520 FvH4_1g20520 FvH4_1g20520 FvH4_1g20520 FvH4_1g20520 FvH4_1g20520 FvH4_5g36830 FvH4_5g36830 FvH4_5g36830 FvH4_5g36830 FvH4_5g36830 FvH4_5g36840 FvH4_5g36840 FvH4_5g36840
malus_domestica	MD01G1033400.v1.1 MD08G1186500.v1.1 MD15G1372500.v1.1
prunus_persica	Prupe.1G521100_v2.0.a1 Prupe.1G521100_v2.0.a1 Prupe.1G521100_v2.0.a1 Prupe.1G521100_v2.0.a1 Prupe.1G521100_v2.0.a1 Prupe.6G190900_v2.0.a1 Prupe.6G190900_v2.0.a1 Prupe.6G190900_v2.0.a1
pyrus_communis	pycom01g06090 pycom08g16030 pycom15g33350
rosa_chinensis	RchiOBHm_Chr2g0112771 RchiOBHm_Chr7g0243381 RchiOBHm_Chr7g0243391
rosa_laevigata	RLG00000000850 RLG00000000851 RLG00000018008
rosa_multiflora	Rmu_co8087500.1_g000001 Rmu_sc0001036.1_g000019 Rmu_sc0001036.1_g000027 Rmu_sc0001708.1_g000033 Rmu_sc0004612.1_g000003 Rmu_sc0024527.1_g000001
rosa_roxburghii	Rroxscaffold_2G00131160 Rroxscaffold_3G00222130 Rroxscaffold_3G00222140
rosa_rugosa	Rorug02G0182300 Rorug02G0182400 Rorug02G0182500 Rorug02G0182600 Rorug07G0318700 Rorug07G0318800 Rorug07G0318900 Rorug07G0319000 Rorug07G0319000
rosa_samantha	Rh2AG237000 Rh2BG249900 Rh2CG241000 Rh2DG244500 Rh7AG475000 Rh7AG475100 Rh7BG444900 Rh7BG445000 Rh7CG491200 Rh7CG491300 Rh7DG459500 Rh7DG459600
rosa_wichuraiana	Rw2G018330 Rw7G039500 Rw7G039520 Rw7G039530

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	398
AcsI	RAATTY	1 cut(s)	407
AcuI	CTGAAG	1 cut(s)	107
AfaI	GTAC	1 cut(s)	109
AfiI	CCNNNNNNNGG	1 cut(s)	242
AgsI	TTSAA	1 cut(s)	136
AjnI	CCWGG	3 cut(s)	214, 235, 374
AluBI	AGCT	3 cut(s)	148, 291, 414
AluI	AGCT	3 cut(s)	148, 291, 414
Alw21I	GWGCWC	1 cut(s)	150
AlwNI	CAGNNNCTG	1 cut(s)	116
AoxI	GGCC	2 cut(s)	372, 455
ApeKI	GCWGC	2 cut(s)	56, 315
ApoI	RAATTY	1 cut(s)	407
ArsI	GACNNNNNNTTYG	4 cut(s)	182, 186, 214, 218
AspS9I	GGNCC	2 cut(s)	233, 456
AvaII	GGWCC	1 cut(s)	233
BanII	GRGCYC	1 cut(s)	150
BbsI	GAAGAC	1 cut(s)	387
Bbv12I	GWGCWC	1 cut(s)	150
BbvI	GCAGC	2 cut(s)	68, 302
BccI	CCATC	3 cut(s)	3, 304, 416
BciT130I	CCWGG	3 cut(s)	216, 237, 376
BfaI	CTAG	1 cut(s)	167
BfmI	CTRYAG	1 cut(s)	175
BisI	GCNGC	2 cut(s)	57, 316
BlsI	GCNGC	2 cut(s)	58, 317
Bme1390I	CCNGG	3 cut(s)	216, 237, 376
Bme18I	GGWCC	1 cut(s)	233
BmgT120I	GGNCC	2 cut(s)	233, 456
BmiI	GGNNCC	1 cut(s)	458
BmrFI	CCNGG	3 cut(s)	216, 237, 376
BmsI	GCATC	1 cut(s)	54
BpiI	GAAGAC	1 cut(s)	387
Bpu10I	CCTNAGC	1 cut(s)	144
BpuEI	CTTGAG	3 cut(s)	15, 59, 104
BsaJI	CCNNGG	3 cut(s)	214, 215, 375
Bsc4I	CCNNNNNNNGG	1 cut(s)	242
Bse3DI	GCAATG	1 cut(s)	253
BseBI	CCWGG	3 cut(s)	216, 237, 376
BseDI	CCNNGG	3 cut(s)	214, 215, 375
BseGI	GGATG	3 cut(s)	14, 265, 406
BseLI	CCNNNNNNNGG	1 cut(s)	242
BseMI	GCAATG	1 cut(s)	253
BseMII	CTCAG	2 cut(s)	135, 291
BseXI	GCAGC	2 cut(s)	68, 302
BseYI	CCCAGC	1 cut(s)	443
BshFI	GGCC	2 cut(s)	374, 457
BsiHKAI	GWGCWC	1 cut(s)	150
BslFI	GGGAC	1 cut(s)	317
BslI	CCNNNNNNNGG	1 cut(s)	242
BsmFI	GGGAC	1 cut(s)	317
BsnI	GGCC	2 cut(s)	374, 457
Bsp1286I	GDGCHC	1 cut(s)	150
Bsp143I	GATC	1 cut(s)	385
BspACI	CCGC	1 cut(s)	398
BspANI	GGCC	2 cut(s)	374, 457
BspCNI	CTCAG	2 cut(s)	136, 290
BspLI	GGNNCC	1 cut(s)	458
BsrDI	GCAATG	1 cut(s)	253
BssECI	CCNNGG	3 cut(s)	214, 215, 375
BssMI	GATC	1 cut(s)	385
Bst2UI	CCWGG	3 cut(s)	216, 237, 376
Bst4CI	ACNGT	2 cut(s)	140, 179
BstDEI	CTNAG	3 cut(s)	144, 277, 295
BstF5I	GGATG	3 cut(s)	14, 265, 406
BstKTI	GATC	1 cut(s)	388
BstMBI	GATC	1 cut(s)	385
BstMWI	GCNNNNNNNGC	1 cut(s)	56
BstNI	CCWGG	3 cut(s)	216, 237, 376
BstSCI	CCNGG	3 cut(s)	214, 235, 374
BstSFI	CTRYAG	1 cut(s)	175
BstV1I	GCAGC	2 cut(s)	68, 302
BstV2I	GAAGAC	1 cut(s)	387
BsuRI	GGCC	2 cut(s)	374, 457
BtsCI	GGATG	3 cut(s)	14, 265, 406
BtsIMutI	CAGTG	1 cut(s)	184
CaiI	CAGNNNCTG	1 cut(s)	116
Cfr13I	GGNCC	2 cut(s)	233, 456
CsiI	ACCWGGT	1 cut(s)	235
Csp6I	GTAC	1 cut(s)	108
CviJI	RGCY	9 cut(s)	45, 59, 148, 220, 291, 315, 374, 414, 457
CviKI_1	RGCY	9 cut(s)	45, 59, 148, 220, 291, 315, 374, 414, 457
CviQI	GTAC	1 cut(s)	108
DdeI	CTNAG	3 cut(s)	144, 277, 295
DpnI	GATC	1 cut(s)	387
DpnII	GATC	1 cut(s)	385
EciI	GGCGGA	1 cut(s)	413
Ecl136II	GAGCTC	1 cut(s)	148
Eco147I	AGGCCT	1 cut(s)	374
Eco24I	GRGCYC	1 cut(s)	150
Eco47I	GGWCC	1 cut(s)	233
Eco53kI	GAGCTC	1 cut(s)	148
Eco57I	CTGAAG	1 cut(s)	107
EcoICRI	GAGCTC	1 cut(s)	148
EcoRII	CCWGG	3 cut(s)	214, 235, 374
EcoT38I	GRGCYC	1 cut(s)	150
FaiI	YATR	6 cut(s)	6, 98, 339, 351, 395, 420
FalI	AAGNNNNNCTT	2 cut(s)	29, 61
FaqI	GGGAC	1 cut(s)	317
Fnu4HI	GCNGC	2 cut(s)	57, 316
FokI	GGATG	3 cut(s)	21, 272, 413
FriOI	GRGCYC	1 cut(s)	150
Fsp4HI	GCNGC	2 cut(s)	57, 316
FspBI	CTAG	1 cut(s)	167
GluI	GCNGC	2 cut(s)	57, 316
GsaI	CCCAGC	1 cut(s)	447
HaeIII	GGCC	2 cut(s)	374, 457
HinfI	GANTC	1 cut(s)	26
Hpy188I	TCNGA	1 cut(s)	126
Hpy188III	TCNNGA	4 cut(s)	32, 143, 205, 434
HpyCH4III	ACNGT	2 cut(s)	140, 179
HpyCH4IV	ACGT	1 cut(s)	162
HpyCH4V	TGCA	1 cut(s)	50
HpyF10VI	GCNNNNNNNGC	1 cut(s)	56
HpyF3I	CTNAG	3 cut(s)	144, 277, 295
HpySE526I	ACGT	1 cut(s)	162
Kzo9I	GATC	1 cut(s)	385
LmnI	GCTCC	2 cut(s)	153, 272
Lsp1109I	GCAGC	2 cut(s)	68, 302
LweI	GCATC	1 cut(s)	54
MabI	ACCWGGT	1 cut(s)	235
MaeI	CTAG	1 cut(s)	167
MaeII	ACGT	1 cut(s)	162
MaeIII	GTNAC	1 cut(s)	87
MalI	GATC	1 cut(s)	387
MboI	GATC	1 cut(s)	385
MboII	GAAGA	3 cut(s)	276, 377, 392
MhlI	GDGCHC	1 cut(s)	150
MluCI	AATT	2 cut(s)	186, 407
MlyI	GAGTC	1 cut(s)	20
MmeI	TCCRAC	1 cut(s)	211
MnlI	CCTC	4 cut(s)	34, 244, 334, 364
MseI	TTAA	1 cut(s)	158
MspR9I	CCNGG	3 cut(s)	216, 237, 376
MvaI	CCWGG	3 cut(s)	216, 237, 376
MwoI	GCNNNNNNNGC	1 cut(s)	56
NdeII	GATC	1 cut(s)	385
NlaIV	GGNNCC	1 cut(s)	458
PasI	CCCWGGG	1 cut(s)	215
PceI	AGGCCT	1 cut(s)	374
PcsI	WCGNNNNNNNCGW	1 cut(s)	97
PkrI	GCNGC	2 cut(s)	58, 317
PleI	GAGTC	1 cut(s)	20
PpsI	GAGTC	1 cut(s)	20
Psp124BI	GAGCTC	1 cut(s)	150
Psp6I	CCWGG	3 cut(s)	214, 235, 374
PspFI	CCCAGC	1 cut(s)	443
PspGI	CCWGG	3 cut(s)	214, 235, 374
PspN4I	GGNNCC	1 cut(s)	458
PspPI	GGNCC	2 cut(s)	233, 456
PstNI	CAGNNNCTG	1 cut(s)	116
RsaI	GTAC	1 cut(s)	109
RsaNI	GTAC	1 cut(s)	108
SacI	GAGCTC	1 cut(s)	150
SaqAI	TTAA	1 cut(s)	158
SatI	GCNGC	2 cut(s)	57, 316
Sau3AI	GATC	1 cut(s)	385
Sau96I	GGNCC	2 cut(s)	233, 456
SchI	GAGTC	1 cut(s)	20
ScrFI	CCNGG	3 cut(s)	216, 237, 376
SduI	GDGCHC	1 cut(s)	150
SetI	ASST	8 cut(s)	84, 118, 150, 165, 241, 293, 345, 416
SexAI	ACCWGGT	1 cut(s)	235
SfaNI	GCATC	1 cut(s)	54
SfcI	CTRYAG	1 cut(s)	175
SinI	GGWCC	1 cut(s)	233
SmlI	CTYRAG	3 cut(s)	30, 74, 83
SmoI	CTYRAG	3 cut(s)	30, 74, 83
Sse9I	AATT	2 cut(s)	186, 407
SseBI	AGGCCT	1 cut(s)	374
SsiI	CCGC	1 cut(s)	398
SspMI	CTAG	1 cut(s)	167
SstI	GAGCTC	1 cut(s)	150
StuI	AGGCCT	1 cut(s)	374
StyD4I	CCNGG	3 cut(s)	214, 235, 374
TaaI	ACNGT	2 cut(s)	140, 179
TaiI	ACGT	1 cut(s)	165
TasI	AATT	2 cut(s)	186, 407
TatI	WGTACW	1 cut(s)	107
Tru1I	TTAA	1 cut(s)	158
Tru9I	TTAA	1 cut(s)	158
TscAI	CASTG	1 cut(s)	184
TseI	GCWGC	2 cut(s)	56, 315
TspDTI	ATGAA	1 cut(s)	378
TspRI	CASTG	1 cut(s)	184
VpaK11BI	GGWCC	1 cut(s)	233
XapI	RAATTY	1 cut(s)	407
XspI	CTAG	1 cut(s)	167

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.