Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8098122.1

Orthogroup ID

OG0000854

Physical Location & Seq

Genomic Coordinates Reverse (-)

38 .. 589

Gene Structure 552 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8098122.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 552 bp

atgaagagcagtcgttctcatggaatcaatttgagtattggtggtggcaagtcaaagagcagttccaagaaaggcaaggaaaaatgtgtagataatgggatcagtagttcaaaagatgctttgaagttgaattgtaaaccttctgtcgaagatgcagcggtcgtattgaagaatgatcattgctgcagcaaaggaaagtcaaagatatcagttgaggatgaacagatcaacctggattctgggaatcatatgccgatgggtcagaatggttctcagtcagctggtggcagctcaaagaaaaatttggggaaaggagctaataagcaacaaaagaaggttcccaagtttcttagaaaccgtcttggtgatgatgctgtagcacttgcagaacttggtgatgctgaaaccggtcctgacctgattgaagaaaaaacagatacagacaaggatccccccgaagggttgccagttcgtggtgtttggcaaaatggaggtggccatagacttgtgaaattgaccatgagaaaccctccaaaacgaggagttgtctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

183

Amino Acids

19.36

Weight (kDa)

9.49

Isoelectric Point (pI)

35.47

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000854)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G47090 AT2G47090 AT2G47090 AT2G47090 AT2G47090 AT3G62240
fragaria_vesca	FvH4_3g07600 FvH4_6g08350 FvH4_6g08350 FvH4_6g08350 FvH4_6g08350 FvH4_7g03760 FvH4_7g03760 FvH4_7g03760
malus_domestica	MD02G1277600.v1.1 MD04G1187900.v1.1 MD07G1045700.v1.1
prunus_persica	Prupe.2G042900_v2.0.a1 Prupe.6G306300_v2.0.a1 Prupe.6G306300_v2.0.a1 Prupe.6G306300_v2.0.a1 Prupe.6G306300_v2.0.a1 Prupe.6G306300_v2.0.a1 Prupe.6G306300_v2.0.a1
pyrus_communis	pycom02g23760 pycom02g23770 pycom04g16610 pycom04g16640 pycom07g03260 pycom07g03270
rosa_chinensis	RchiOBHm_Chr1g0326951 RchiOBHm_Chr3g0458251 RchiOBHm_Chr5g0011091
rosa_laevigata	RLG00000025171 RLG00000030049 RLG00000031809
rosa_multiflora	Rmu_co8031236.1_g000001 Rmu_co8098122.1_g000001 Rmu_co8217558.1_g000001 Rmu_co8502817.1_g000001 Rmu_sc0000795.1_g000001 Rmu_sc0003315.1_g000001 Rmu_sc0005999.1_g000013 Rmu_sc0007338.1_g000004
rosa_roxburghii	Rroxscaffold_1G00065320 Rroxscaffold_4G00323480 Rroxscaffold_6G00421200
rosa_rugosa	Rorug01G0062400 Rorug01G0062500 Rorug03G0025600 Rorug03G0025700
rosa_samantha	Rh1AG079500 Rh1BG063700 Rh1CG077100 Rh1DG083600 Rh3AG086400 Rh3BG089100 Rh3CG089700 Rh3DG090200 Rh5AG087400 Rh5BG082200 Rh5CG095000 Rh5DG081800
rosa_wichuraiana	Rw0G000180 Rw0G017770 Rw1G006310 Rw3G007330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	473
AciI	CCGC	1 cut(s)	158
AclWI	GGATC	3 cut(s)	107, 443, 456
AcoI	YGGCCR	1 cut(s)	496
AcsI	RAATTY	1 cut(s)	301
AfiI	CCNNNNNNNGG	4 cut(s)	458, 459, 473, 539
AgeI	ACCGGT	1 cut(s)	407
AgsI	TTSAA	5 cut(s)	111, 124, 130, 169, 425
AjnI	CCWGG	1 cut(s)	231
AloI	GAACNNNNNNTCC	2 cut(s)	91, 123
AluBI	AGCT	3 cut(s)	281, 291, 317
AluI	AGCT	3 cut(s)	281, 291, 317
AlwI	GGATC	3 cut(s)	107, 443, 456
AoxI	GGCC	1 cut(s)	496
ApeKI	GCWGC	4 cut(s)	155, 183, 186, 288
ApoI	RAATTY	1 cut(s)	301
AsiGI	ACCGGT	1 cut(s)	407
AspS9I	GGNCC	1 cut(s)	410
AsuHPI	GGTGA	2 cut(s)	377, 407
AvaII	GGWCC	1 cut(s)	410
BalI	TGGCCA	1 cut(s)	498
BamHI	GGATCC	1 cut(s)	448
BbvI	GCAGC	4 cut(s)	167, 170, 198, 300
BccI	CCATC	1 cut(s)	250
BciT130I	CCWGG	1 cut(s)	233
BclI	TGATCA	1 cut(s)	175
BfmI	CTRYAG	2 cut(s)	184, 375
BisI	GCNGC	4 cut(s)	156, 184, 187, 289
BlsI	GCNGC	4 cut(s)	157, 185, 188, 290
Bme1390I	CCNGG	1 cut(s)	233
Bme18I	GGWCC	1 cut(s)	410
BmgT120I	GGNCC	1 cut(s)	410
BmiI	GGNNCC	2 cut(s)	339, 450
BmrFI	CCNGG	1 cut(s)	233
BmsI	GCATC	4 cut(s)	106, 142, 361, 388
BplI	GAGNNNNNCTC	2 cut(s)	514, 546
BsaWI	WCCGGW	1 cut(s)	407
Bsc4I	CCNNNNNNNGG	4 cut(s)	458, 459, 473, 539
Bse118I	RCCGGY	1 cut(s)	407
Bse1I	ACTGG	1 cut(s)	467
Bse3DI	GCAATG	1 cut(s)	178
BseBI	CCWGG	1 cut(s)	233
BseGI	GGATG	1 cut(s)	223
BseLI	CCNNNNNNNGG	4 cut(s)	458, 459, 473, 539
BseMI	GCAATG	1 cut(s)	178
BseMII	CTCAG	1 cut(s)	287
BseNI	ACTGG	1 cut(s)	467
BseXI	GCAGC	4 cut(s)	167, 170, 198, 300
Bsh1285I	CGRYCG	1 cut(s)	162
BshFI	GGCC	1 cut(s)	498
BshTI	ACCGGT	1 cut(s)	407
BsiEI	CGRYCG	1 cut(s)	162
BsiSI	CCGG	1 cut(s)	408
BslI	CCNNNNNNNGG	4 cut(s)	458, 459, 473, 539
BsnI	GGCC	1 cut(s)	498
Bsp143I	GATC	4 cut(s)	99, 175, 225, 448
BspACI	CCGC	1 cut(s)	158
BspANI	GGCC	1 cut(s)	498
BspCNI	CTCAG	1 cut(s)	286
BspLI	GGNNCC	2 cut(s)	339, 450
BspMAI	CTGCAG	1 cut(s)	188
BspPI	GGATC	3 cut(s)	107, 443, 456
BsrDI	GCAATG	1 cut(s)	178
BsrFI	RCCGGY	1 cut(s)	407
BsrI	ACTGG	1 cut(s)	467
BssAI	RCCGGY	1 cut(s)	407
BssMI	GATC	4 cut(s)	99, 175, 225, 448
Bst2UI	CCWGG	1 cut(s)	233
Bst4CI	ACNGT	1 cut(s)	359
BstDEI	CTNAG	2 cut(s)	273, 350
BstF5I	GGATG	1 cut(s)	223
BstKTI	GATC	4 cut(s)	102, 178, 228, 451
BstMBI	GATC	4 cut(s)	99, 175, 225, 448
BstMCI	CGRYCG	1 cut(s)	162
BstNI	CCWGG	1 cut(s)	233
BstSCI	CCNGG	1 cut(s)	231
BstSFI	CTRYAG	2 cut(s)	184, 375
BstV1I	GCAGC	4 cut(s)	167, 170, 198, 300
BstX2I	RGATCY	1 cut(s)	448
BstYI	RGATCY	1 cut(s)	448
BsuRI	GGCC	1 cut(s)	498
BtsCI	GGATG	1 cut(s)	223
Cfr10I	RCCGGY	1 cut(s)	407
Cfr13I	GGNCC	1 cut(s)	410
CspAI	ACCGGT	1 cut(s)	407
CviAII	CATG	2 cut(s)	20, 520
CviJI	RGCY	4 cut(s)	281, 291, 317, 498
CviKI_1	RGCY	4 cut(s)	281, 291, 317, 498
DdeI	CTNAG	2 cut(s)	273, 350
DpnI	GATC	4 cut(s)	101, 177, 227, 450
DpnII	GATC	4 cut(s)	99, 175, 225, 448
EaeI	YGGCCR	1 cut(s)	496
Eco32I	GATATC	1 cut(s)	207
Eco47I	GGWCC	1 cut(s)	410
EcoRII	CCWGG	1 cut(s)	231
EcoRV	GATATC	1 cut(s)	207
FaeI	CATG	2 cut(s)	23, 523
FaiI	YATR	5 cut(s)	21, 249, 251, 501, 521
FatI	CATG	2 cut(s)	19, 519
FauNDI	CATATG	1 cut(s)	249
FbaI	TGATCA	1 cut(s)	175
Fnu4HI	GCNGC	4 cut(s)	156, 184, 187, 289
FokI	GGATG	1 cut(s)	230
Fsp4HI	GCNGC	4 cut(s)	156, 184, 187, 289
GluI	GCNGC	4 cut(s)	156, 184, 187, 289
HaeIII	GGCC	1 cut(s)	498
HapII	CCGG	1 cut(s)	408
Hin1II	CATG	2 cut(s)	23, 523
HinfI	GANTC	3 cut(s)	24, 236, 244
HpaII	CCGG	1 cut(s)	408
HphI	GGTGA	2 cut(s)	377, 407
Hpy166II	GTNNAC	1 cut(s)	137
Hpy188I	TCNGA	2 cut(s)	264, 551
Hpy188III	TCNNGA	1 cut(s)	413
Hpy8I	GTNNAC	1 cut(s)	137
HpyAV	CCTTC	3 cut(s)	150, 328, 452
HpyCH4III	ACNGT	1 cut(s)	359
HpyCH4V	TGCA	3 cut(s)	155, 186, 386
HpyF3I	CTNAG	2 cut(s)	273, 350
Hsp92II	CATG	2 cut(s)	23, 523
Ksp22I	TGATCA	1 cut(s)	175
Kzo9I	GATC	4 cut(s)	99, 175, 225, 448
LmnI	GCTCC	1 cut(s)	314
LpnPI	CCDG	8 cut(s)	218, 225, 245, 267, 421, 426, 431, 480
Lsp1109I	GCAGC	4 cut(s)	167, 170, 198, 300
LweI	GCATC	4 cut(s)	106, 142, 361, 388
MalI	GATC	4 cut(s)	101, 177, 227, 450
MboI	GATC	4 cut(s)	99, 175, 225, 448
MboII	GAAGA	4 cut(s)	16, 161, 181, 437
MflI	RGATCY	1 cut(s)	448
MlsI	TGGCCA	1 cut(s)	498
MluCI	AATT	4 cut(s)	28, 130, 301, 512
MluNI	TGGCCA	1 cut(s)	498
MnlI	CCTC	4 cut(s)	208, 485, 533, 540
Mox20I	TGGCCA	1 cut(s)	498
MscI	TGGCCA	1 cut(s)	498
Msp20I	TGGCCA	1 cut(s)	498
MspA1I	CMGCKG	2 cut(s)	158, 281
MspI	CCGG	1 cut(s)	408
MspR9I	CCNGG	1 cut(s)	233
MvaI	CCWGG	1 cut(s)	233
NdeI	CATATG	1 cut(s)	249
NdeII	GATC	4 cut(s)	99, 175, 225, 448
NlaIII	CATG	2 cut(s)	23, 523
NlaIV	GGNNCC	2 cut(s)	339, 450
PfeI	GAWTC	3 cut(s)	24, 236, 244
PflMI	CCANNNNNTGG	1 cut(s)	473
PinAI	ACCGGT	1 cut(s)	407
PkrI	GCNGC	4 cut(s)	157, 185, 188, 290
Psp6I	CCWGG	1 cut(s)	231
PspGI	CCWGG	1 cut(s)	231
PspN4I	GGNNCC	2 cut(s)	339, 450
PspPI	GGNCC	1 cut(s)	410
PstI	CTGCAG	1 cut(s)	188
PsuI	RGATCY	1 cut(s)	448
PvuII	CAGCTG	1 cut(s)	281
SatI	GCNGC	4 cut(s)	156, 184, 187, 289
Sau3AI	GATC	4 cut(s)	99, 175, 225, 448
Sau96I	GGNCC	1 cut(s)	410
ScrFI	CCNGG	1 cut(s)	233
SetI	ASST	8 cut(s)	142, 234, 283, 293, 319, 339, 420, 496
SfaNI	GCATC	4 cut(s)	106, 142, 361, 388
SfcI	CTRYAG	2 cut(s)	184, 375
SinI	GGWCC	1 cut(s)	410
Sse9I	AATT	4 cut(s)	28, 130, 301, 512
SsiI	CCGC	1 cut(s)	158
StyD4I	CCNGG	1 cut(s)	231
TaaI	ACNGT	1 cut(s)	359
TaqI	TCGA	1 cut(s)	147
TasI	AATT	4 cut(s)	28, 130, 301, 512
TfiI	GAWTC	3 cut(s)	24, 236, 244
TseI	GCWGC	4 cut(s)	155, 183, 186, 288
TspDTI	ATGAA	2 cut(s)	17, 234
Van91I	CCANNNNNTGG	1 cut(s)	473
VpaK11BI	GGWCC	1 cut(s)	410
XapI	RAATTY	1 cut(s)	301

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.