Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8188422.1

Orthogroup ID

OG0001853

Physical Location & Seq

Genomic Coordinates Reverse (-)

44 .. 487

Gene Structure 444 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8188422.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 444 bp

atgactgctagaaatttcttgcaattacagccagaagctgtgagggctaagatcacaaagggttcagaaactgctcttcacattgcagctggggcaaaacgtacactttttgttgaggagctagtaaaatggatgacaccaaatgaccttgaattgaagaatgatgtaggaaacaccgccctttattttgctgctgtatctggtatcaaaaggattgctgaggtaatggtggatattaacccaagattacctcagatccgaggtactaaagatctaacacctcttcatatggctacattgctaggccacaaagaaattgtatggtatctatacgataagacaattttgacagaacaagattacatagggcttcttatttctgccataacggcagatctttatggtaagcatagaaaattaaggatattgcttcaacacacatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ank_2 PGG

Protein Analysis

147

Amino Acids

16.61

Weight (kDa)

9.36

Isoelectric Point (pI)

34.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001853)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G35810
fragaria_vesca	FvH4_1g20460 FvH4_4g07110 FvH4_4g07110 FvH4_4g07110
malus_domestica	MD05G1166100.v1.1
prunus_persica	Prupe.1G545900_v2.0.a1 Prupe.1G545900_v2.0.a1
pyrus_communis	pycom05g15470 pycom05g15480
rosa_chinensis	RchiOBHm_Chr2g0112741 RchiOBHm_Chr4g0399281 RchiOBHm_Chr5g0059341 RchiOBHm_Chr5g0059351
rosa_laevigata	RLG00000009279 RLG00000018005
rosa_multiflora	Rmu_co8188422.1_g000001 Rmu_co8394355.1_g000001 Rmu_sc0000375.1_g000019 Rmu_sc0000375.1_g000021 Rmu_sc0003135.1_g000013 Rmu_sc0035003.1_g000001 Rmu_sc0042317.1_g000002
rosa_roxburghii	Rroxscaffold_2G00131190 Rroxscaffold_2G00131200 Rroxscaffold_5G00344220
rosa_rugosa	Rorug02G0182000 Rorug04G0016000 Rorug04G0016100 Rorug04G0016200
rosa_samantha	Rh2AG236700 Rh2BG249500 Rh2BG249600 Rh2CG240700 Rh2DG244100 Rh2DG244200 Rh4AG093900 Rh4BG091300 Rh4CG102100 Rh4DG086000 Rh5AG386900 Rh5DG414600 Rh7DG334500
rosa_wichuraiana	Rw2G018300 Rw4G007700 Rw5G036400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	177
AclWI	GGATC	1 cut(s)	250
AcsI	RAATTY	1 cut(s)	13
AfaI	GTAC	2 cut(s)	103, 265
AgsI	TTSAA	3 cut(s)	152, 157, 434
AluBI	AGCT	3 cut(s)	38, 89, 121
AluI	AGCT	3 cut(s)	38, 89, 121
AlwI	GGATC	1 cut(s)	250
AlwNI	CAGNNNCTG	2 cut(s)	38, 71
AoxI	GGCC	1 cut(s)	304
ApeKI	GCWGC	2 cut(s)	86, 191
ApoI	RAATTY	1 cut(s)	13
BbvCI	CCTCAGC	1 cut(s)	219
BbvI	GCAGC	2 cut(s)	98, 178
BceAI	ACGGC	1 cut(s)	405
BfaI	CTAG	3 cut(s)	9, 122, 302
BglI	GCCNNNNNGGC	1 cut(s)	389
BglII	AGATCT	2 cut(s)	271, 394
BisI	GCNGC	2 cut(s)	87, 192
BlsI	GCNGC	2 cut(s)	88, 193
Bpu10I	CCTNAGC	1 cut(s)	219
BsaJI	CCNNGG	1 cut(s)	259
Bse3DI	GCAATG	2 cut(s)	81, 296
BseDI	CCNNGG	1 cut(s)	259
BseGI	GGATG	1 cut(s)	138
BseMI	GCAATG	2 cut(s)	81, 296
BseMII	CTCAG	2 cut(s)	210, 266
BseRI	GAGGAG	1 cut(s)	131
BseXI	GCAGC	2 cut(s)	98, 178
BseYI	CCCAGC	1 cut(s)	89
BshFI	GGCC	1 cut(s)	306
BsnI	GGCC	1 cut(s)	306
Bsp143I	GATC	4 cut(s)	51, 255, 271, 394
BspACI	CCGC	1 cut(s)	177
BspANI	GGCC	1 cut(s)	306
BspCNI	CTCAG	2 cut(s)	211, 265
BspPI	GGATC	1 cut(s)	250
BspQI	GCTCTTC	1 cut(s)	81
BsrDI	GCAATG	2 cut(s)	81, 296
BssECI	CCNNGG	1 cut(s)	259
BssMI	GATC	4 cut(s)	51, 255, 271, 394
Bst6I	CTCTTC	2 cut(s)	81, 288
BstDEI	CTNAG	3 cut(s)	48, 219, 252
BstF5I	GGATG	1 cut(s)	138
BstKTI	GATC	4 cut(s)	54, 258, 274, 397
BstMBI	GATC	4 cut(s)	51, 255, 271, 394
BstMWI	GCNNNNNNNGC	4 cut(s)	28, 44, 92, 389
BstV1I	GCAGC	2 cut(s)	98, 178
BstX2I	RGATCY	3 cut(s)	255, 271, 394
BstYI	RGATCY	3 cut(s)	255, 271, 394
BsuRI	GGCC	1 cut(s)	306
BtsCI	GGATG	1 cut(s)	138
CaiI	CAGNNNCTG	2 cut(s)	38, 71
Csp6I	GTAC	2 cut(s)	102, 264
CviAII	CATG	1 cut(s)	441
CviJI	RGCY	8 cut(s)	31, 38, 47, 89, 121, 293, 306, 370
CviKI_1	RGCY	8 cut(s)	31, 38, 47, 89, 121, 293, 306, 370
CviQI	GTAC	2 cut(s)	102, 264
DdeI	CTNAG	3 cut(s)	48, 219, 252
DpnI	GATC	4 cut(s)	53, 257, 273, 396
DpnII	GATC	4 cut(s)	51, 255, 271, 394
Eam1104I	CTCTTC	2 cut(s)	81, 288
EarI	CTCTTC	2 cut(s)	81, 288
FaeI	CATG	1 cut(s)	444
FaiI	YATR	9 cut(s)	288, 290, 322, 331, 365, 386, 402, 411, 442
FatI	CATG	1 cut(s)	440
FauNDI	CATATG	1 cut(s)	288
Fnu4HI	GCNGC	2 cut(s)	87, 192
FokI	GGATG	1 cut(s)	145
Fsp4HI	GCNGC	2 cut(s)	87, 192
FspBI	CTAG	3 cut(s)	9, 122, 302
GluI	GCNGC	2 cut(s)	87, 192
GsaI	CCCAGC	1 cut(s)	93
HaeIII	GGCC	1 cut(s)	306
Hin1II	CATG	1 cut(s)	444
Hpy166II	GTNNAC	1 cut(s)	104
Hpy188I	TCNGA	3 cut(s)	67, 255, 260
Hpy8I	GTNNAC	1 cut(s)	104
HpyCH4IV	ACGT	1 cut(s)	100
HpyCH4V	TGCA	2 cut(s)	22, 86
HpyF10VI	GCNNNNNNNGC	4 cut(s)	28, 44, 92, 389
HpyF3I	CTNAG	3 cut(s)	48, 219, 252
HpySE526I	ACGT	1 cut(s)	100
Hsp92II	CATG	1 cut(s)	444
Kzo9I	GATC	4 cut(s)	51, 255, 271, 394
LguI	GCTCTTC	1 cut(s)	81
LmnI	GCTCC	1 cut(s)	118
LpnPI	CCDG	3 cut(s)	45, 75, 186
Lsp1109I	GCAGC	2 cut(s)	98, 178
MaeI	CTAG	3 cut(s)	9, 122, 302
MaeII	ACGT	1 cut(s)	100
MalI	GATC	4 cut(s)	53, 257, 273, 396
MboI	GATC	4 cut(s)	51, 255, 271, 394
MboII	GAAGA	3 cut(s)	68, 169, 275
MflI	RGATCY	3 cut(s)	255, 271, 394
MluCI	AATT	6 cut(s)	13, 23, 152, 315, 342, 416
MnlI	CCTC	6 cut(s)	36, 109, 214, 254, 261, 291
MseI	TTAA	2 cut(s)	237, 419
MspA1I	CMGCKG	1 cut(s)	89
MwoI	GCNNNNNNNGC	4 cut(s)	28, 44, 92, 389
NdeI	CATATG	1 cut(s)	288
NdeII	GATC	4 cut(s)	51, 255, 271, 394
NlaIII	CATG	1 cut(s)	444
PciSI	GCTCTTC	1 cut(s)	81
PkrI	GCNGC	2 cut(s)	88, 193
PspFI	CCCAGC	1 cut(s)	89
PstNI	CAGNNNCTG	2 cut(s)	38, 71
PsuI	RGATCY	3 cut(s)	255, 271, 394
PvuII	CAGCTG	1 cut(s)	89
RsaI	GTAC	2 cut(s)	103, 265
RsaNI	GTAC	2 cut(s)	102, 264
SapI	GCTCTTC	1 cut(s)	81
SaqAI	TTAA	2 cut(s)	237, 419
SatI	GCNGC	2 cut(s)	87, 192
Sau3AI	GATC	4 cut(s)	51, 255, 271, 394
SetI	ASST	9 cut(s)	40, 91, 103, 123, 150, 225, 253, 265, 283
Sse9I	AATT	6 cut(s)	13, 23, 152, 315, 342, 416
SsiI	CCGC	1 cut(s)	177
SspMI	CTAG	3 cut(s)	9, 122, 302
TaiI	ACGT	1 cut(s)	103
TasI	AATT	6 cut(s)	13, 23, 152, 315, 342, 416
Tru1I	TTAA	2 cut(s)	237, 419
Tru9I	TTAA	2 cut(s)	237, 419
TseI	GCWGC	2 cut(s)	86, 191
TspDTI	ATGAA	1 cut(s)	275
XapI	RAATTY	1 cut(s)	13
XspI	CTAG	3 cut(s)	9, 122, 302

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.