Rmu_co8394355.1_g000001

ankyrin repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8394355.1
Physical Location & Seq
Forward (+)
437 .. 961
525 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8394355.1_g000001.1.cds

Sequence Viewer

Length: 525 bp
atgtcagagaaactaaccacatcatcgccatttgaagttgaagaaggagtctcaacccaagagaacttcccaaaagaatctgcaggagtagttatgcaagagacatgtggactaacctttggaggcgacaatggcaccgctgccacatccggcagacagtcatttgcaacaagcgatggagggtacagtgcaggtcctccgtctagcaggacgacatgtgcaacaataagctacggaggttactacagcagcggtggaacgtctagctgcagaccaacgtgtcatccgttaccacctggcctcggaacaccaattatcgcaattgttcatagtcctgaatttacgtttggtggatggggtaattctactgaaaatgttgatgtagagattggccatgatcagcaacctgatgatctggaggctacatatactgcagaagaagccgaaagaaaacgaagggaagatgcagcttccccagtaataacccagtcagactccatttcaagtatgtttttgccgatttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

174

Amino Acids

18.23

Weight (kDa)

4.36

Isoelectric Point (pI)

63.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 279
Acc36I ACCTGC 1 cut(s) 182
AccB1I GGYRCC 1 cut(s) 134
AciI CCGC 2 cut(s) 138, 252
AcoI YGGCCR 1 cut(s) 391
AcsI RAATTY 1 cut(s) 338
AfaI GTAC 1 cut(s) 185
AfiI CCNNNNNNNGG 1 cut(s) 302
AflIII ACRYGT 3 cut(s) 104, 215, 278
AgsI TTSAA 3 cut(s) 35, 41, 504
AjnI CCWGG 1 cut(s) 295
AjuI GAANNNNNNNTTGG 2 cut(s) 330, 362
AluBI AGCT 3 cut(s) 231, 267, 470
AluI AGCT 3 cut(s) 231, 267, 470
Alw26I GTCTC 2 cut(s) 55, 95
AoxI GGCC 2 cut(s) 298, 391
ApeKI GCWGC 4 cut(s) 140, 249, 267, 467
ApoI RAATTY 1 cut(s) 338
AspS9I GGNCC 1 cut(s) 194
AvaII GGWCC 1 cut(s) 194
BalI TGGCCA 1 cut(s) 393
BanI GGYRCC 1 cut(s) 134
BbvI GCAGC 4 cut(s) 127, 254, 261, 479
BccI CCATC 2 cut(s) 170, 348
BciT130I CCWGG 1 cut(s) 297
BclI TGATCA 1 cut(s) 397
BcoDI GTCTC 2 cut(s) 55, 95
BfaI CTAG 2 cut(s) 204, 264
BfmI CTRYAG 4 cut(s) 81, 244, 268, 432
BfuAI ACCTGC 1 cut(s) 182
BisI GCNGC 4 cut(s) 141, 250, 268, 468
BlsI GCNGC 4 cut(s) 142, 251, 269, 469
Bme1390I CCNGG 1 cut(s) 297
Bme18I GGWCC 1 cut(s) 194
BmgT120I GGNCC 1 cut(s) 194
BmiI GGNNCC 1 cut(s) 136
BmrFI CCNGG 1 cut(s) 297
BmrI ACTGGG 2 cut(s) 470, 481
BmsI GCATC 1 cut(s) 454
BmuI ACTGGG 2 cut(s) 470, 481
BpmI CTGGAG 1 cut(s) 437
BsaJI CCNNGG 1 cut(s) 301
Bsc4I CCNNNNNNNGG 1 cut(s) 302
Bse1I ACTGG 2 cut(s) 476, 487
BseBI CCWGG 1 cut(s) 297
BseDI CCNNGG 1 cut(s) 301
BseGI GGATG 3 cut(s) 146, 283, 359
BseLI CCNNNNNNNGG 1 cut(s) 302
BseNI ACTGG 2 cut(s) 476, 487
BseXI GCAGC 4 cut(s) 127, 254, 261, 479
BsgI GTGCAG 1 cut(s) 210
BshFI GGCC 2 cut(s) 300, 393
BshNI GGYRCC 1 cut(s) 134
BsiSI CCGG 1 cut(s) 150
BslI CCNNNNNNNGG 1 cut(s) 302
BsmAI GTCTC 2 cut(s) 55, 95
BsnI GGCC 2 cut(s) 300, 393
Bsp143I GATC 2 cut(s) 397, 412
BspACI CCGC 2 cut(s) 138, 252
BspANI GGCC 2 cut(s) 300, 393
BspLI GGNNCC 1 cut(s) 136
BspMAI CTGCAG 3 cut(s) 85, 272, 436
BspMI ACCTGC 1 cut(s) 182
BspT107I GGYRCC 1 cut(s) 134
BsrI ACTGG 2 cut(s) 476, 487
BssECI CCNNGG 1 cut(s) 301
BssMI GATC 2 cut(s) 397, 412
Bst2UI CCWGG 1 cut(s) 297
Bst4CI ACNGT 2 cut(s) 159, 188
BstF5I GGATG 3 cut(s) 146, 283, 359
BstKTI GATC 2 cut(s) 400, 415
BstMAI GTCTC 2 cut(s) 55, 95
BstMBI GATC 2 cut(s) 397, 412
BstMWI GCNNNNNNNGC 2 cut(s) 132, 440
BstNI CCWGG 1 cut(s) 297
BstNSI RCATGY 2 cut(s) 108, 219
BstSCI CCNGG 1 cut(s) 295
BstSFI CTRYAG 4 cut(s) 81, 244, 268, 432
BstV1I GCAGC 4 cut(s) 127, 254, 261, 479
BsuRI GGCC 2 cut(s) 300, 393
BtgZI GCGATG 2 cut(s) 9, 189
BtsCI GGATG 3 cut(s) 146, 283, 359
BtsIMutI CAGTG 1 cut(s) 193
BveI ACCTGC 1 cut(s) 182
Cfr13I GGNCC 1 cut(s) 194
Csp6I GTAC 1 cut(s) 184
CviAII CATG 3 cut(s) 105, 216, 395
CviJI RGCY 7 cut(s) 231, 267, 300, 393, 422, 443, 470
CviKI_1 RGCY 7 cut(s) 231, 267, 300, 393, 422, 443, 470
CviQI GTAC 1 cut(s) 184
DpnI GATC 2 cut(s) 399, 414
DpnII GATC 2 cut(s) 397, 412
DrdI GACNNNNNNGTC 1 cut(s) 279
DseDI GACNNNNNNGTC 1 cut(s) 279
EaeI YGGCCR 1 cut(s) 391
Eco47I GGWCC 1 cut(s) 194
EcoO109I RGGNCCY 1 cut(s) 194
EcoRII CCWGG 1 cut(s) 295
FaeI CATG 3 cut(s) 108, 219, 398
FaiI YATR 8 cut(s) 95, 106, 217, 330, 396, 427, 429, 509
FatI CATG 3 cut(s) 104, 215, 394
FbaI TGATCA 1 cut(s) 397
Fnu4HI GCNGC 4 cut(s) 141, 250, 268, 468
FokI GGATG 3 cut(s) 133, 270, 366
Fsp4HI GCNGC 4 cut(s) 141, 250, 268, 468
FspBI CTAG 2 cut(s) 204, 264
GluI GCNGC 4 cut(s) 141, 250, 268, 468
GsuI CTGGAG 1 cut(s) 437
HaeIII GGCC 2 cut(s) 300, 393
HapII CCGG 1 cut(s) 150
Hin1II CATG 3 cut(s) 108, 219, 398
HinfI GANTC 3 cut(s) 48, 77, 494
HpaII CCGG 1 cut(s) 150
Hpy166II GTNNAC 1 cut(s) 110
Hpy188I TCNGA 3 cut(s) 7, 305, 493
Hpy188III TCNNGA 2 cut(s) 335, 416
Hpy8I GTNNAC 1 cut(s) 110
HpyAV CCTTC 2 cut(s) 38, 450
HpyCH4III ACNGT 2 cut(s) 159, 188
HpyCH4IV ACGT 3 cut(s) 260, 278, 344
HpyCH4V TGCA 8 cut(s) 83, 97, 167, 191, 221, 270, 434, 467
HpyF10VI GCNNNNNNNGC 2 cut(s) 132, 440
HpySE526I ACGT 3 cut(s) 260, 278, 344
Hsp92II CATG 3 cut(s) 108, 219, 398
Ksp22I TGATCA 1 cut(s) 397
Kzo9I GATC 2 cut(s) 397, 412
Lsp1109I GCAGC 4 cut(s) 127, 254, 261, 479
LweI GCATC 1 cut(s) 454
MaeI CTAG 2 cut(s) 204, 264
MaeII ACGT 3 cut(s) 260, 278, 344
MaeIII GTNAC 2 cut(s) 239, 288
MalI GATC 2 cut(s) 399, 414
MboI GATC 2 cut(s) 397, 412
MboII GAAGA 3 cut(s) 53, 449, 473
MfeI CAATTG 1 cut(s) 321
MlsI TGGCCA 1 cut(s) 393
MluCI AATT 4 cut(s) 312, 321, 338, 361
MluNI TGGCCA 1 cut(s) 393
MlyI GAGTC 2 cut(s) 57, 488
MnlI CCTC 6 cut(s) 116, 173, 207, 230, 311, 412
Mox20I TGGCCA 1 cut(s) 393
MscI TGGCCA 1 cut(s) 393
MseI TTAA 1 cut(s) 523
Msp20I TGGCCA 1 cut(s) 393
MspA1I CMGCKG 2 cut(s) 140, 252
MspI CCGG 1 cut(s) 150
MspR9I CCNGG 1 cut(s) 297
MunI CAATTG 1 cut(s) 321
MvaI CCWGG 1 cut(s) 297
MwoI GCNNNNNNNGC 2 cut(s) 132, 440
NdeII GATC 2 cut(s) 397, 412
NlaIII CATG 3 cut(s) 108, 219, 398
NlaIV GGNNCC 1 cut(s) 136
NspI RCATGY 2 cut(s) 108, 219
PciI ACATGT 2 cut(s) 104, 215
PcsI WCGNNNNNNNCGW 1 cut(s) 284
PfeI GAWTC 1 cut(s) 77
PkrI GCNGC 4 cut(s) 142, 251, 269, 469
PleI GAGTC 2 cut(s) 56, 488
PpsI GAGTC 2 cut(s) 56, 488
PpuMI RGGWCCY 1 cut(s) 194
PscI ACATGT 2 cut(s) 104, 215
Psp5II RGGWCCY 1 cut(s) 194
Psp6I CCWGG 1 cut(s) 295
PspGI CCWGG 1 cut(s) 295
PspN4I GGNNCC 1 cut(s) 136
PspPI GGNCC 1 cut(s) 194
PspPPI RGGWCCY 1 cut(s) 194
PstI CTGCAG 3 cut(s) 85, 272, 436
RsaI GTAC 1 cut(s) 185
RsaNI GTAC 1 cut(s) 184
SaqAI TTAA 1 cut(s) 523
SatI GCNGC 4 cut(s) 141, 250, 268, 468
Sau3AI GATC 2 cut(s) 397, 412
Sau96I GGNCC 1 cut(s) 194
SchI GAGTC 2 cut(s) 57, 488
ScrFI CCNGG 1 cut(s) 297
SfaNI GCATC 1 cut(s) 454
SfcI CTRYAG 4 cut(s) 81, 244, 268, 432
SinI GGWCC 1 cut(s) 194
Sse9I AATT 4 cut(s) 312, 321, 338, 361
SsiI CCGC 2 cut(s) 138, 252
SspMI CTAG 2 cut(s) 204, 264
StyD4I CCNGG 1 cut(s) 295
TaaI ACNGT 2 cut(s) 159, 188
TaiI ACGT 3 cut(s) 263, 281, 347
TasI AATT 4 cut(s) 312, 321, 338, 361
TfiI GAWTC 1 cut(s) 77
Tru1I TTAA 1 cut(s) 523
Tru9I TTAA 1 cut(s) 523
TscAI CASTG 1 cut(s) 193
TseI GCWGC 4 cut(s) 140, 249, 267, 467
TspDTI ATGAA 1 cut(s) 317
TspGWI ACGGA 3 cut(s) 189, 249, 276
TspRI CASTG 1 cut(s) 193
VpaK11BI GGWCC 1 cut(s) 194
XapI RAATTY 1 cut(s) 338
XceI RCATGY 2 cut(s) 108, 219
XspI CTAG 2 cut(s) 204, 264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.