Rmu_co8210450.1_g000001

Encoded by

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8210450.1
Physical Location & Seq
Reverse (-)
2 .. 711
710 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8210450.1_g000001.1.cds

Sequence Viewer

Length: 710 bp
atgatatcttgttatgttcataatgggcctgcaagtgaggctcttgaactttgtcagctcatgaaagaagtaaatgttaaacttgatttccaggcttatgggatgcatggtcatggcaaggaagccattgatttattcaagaggatggaagaccaaaagattgttccagatcatattatgttttgggctcaagtcttttacattaagggtcaaatggaaactgatgatgggcttgcaaatcaattggggaagatatgtttgcttattgcaattgcaattaatcaattgcatttaaatgaagctgccgctttgtacaagggaatggacacaagtgcaattattcaattacattcaacgaattggttggtccagcctgagcatgaacactgcaaatggtctgctgcaatttttcttgcattaatctcaagttgcctacatgttaccaatcataagcaaaagtttgagaatatcgcaagacttgtcgaggtgttgtgtagtagcaaaagcatccttgtgaaaggagccggtgggattggcttggggttttcttgccaagatcttcttacttgggccaatgcttctgataattctagcatggaaacagacctagacaagctgttagaaagggacttgcttggtgacatagctaaggcattattatttatgatattctgggttagggggcttgatgctatttccaagataaaaga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

236

Amino Acids

26.33

Weight (kDa)

5.9

Isoelectric Point (pI)

20.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 306
AfaI GTAC 1 cut(s) 314
AflIII ACRYGT 1 cut(s) 436
AgsI TTSAA 4 cut(s) 47, 139, 344, 354
AjnI CCWGG 1 cut(s) 90
AjuI GAANNNNNNNTTGG 2 cut(s) 147, 179
AluBI AGCT 4 cut(s) 58, 302, 616, 647
AluI AGCT 4 cut(s) 58, 302, 616, 647
AoxI GGCC 2 cut(s) 26, 570
ApeKI GCWGC 2 cut(s) 302, 401
AseI ATTAAT 2 cut(s) 279, 419
AspS9I GGNCC 3 cut(s) 26, 367, 570
AsuHPI GGTGA 1 cut(s) 650
AvaII GGWCC 1 cut(s) 367
BanII GRGCYC 1 cut(s) 190
BbsI GAAGAC 1 cut(s) 156
BbvI GCAGC 2 cut(s) 289, 388
BccI CCATC 2 cut(s) 139, 221
BciT130I CCWGG 1 cut(s) 92
BfaI CTAG 2 cut(s) 591, 608
BglII AGATCT 1 cut(s) 556
BisI GCNGC 3 cut(s) 303, 306, 402
BlsI GCNGC 3 cut(s) 304, 307, 403
Bme1390I CCNGG 1 cut(s) 92
Bme18I GGWCC 1 cut(s) 367
BmgT120I GGNCC 3 cut(s) 26, 367, 570
BmiI GGNNCC 1 cut(s) 523
BmrFI CCNGG 1 cut(s) 92
BmsI GCATC 3 cut(s) 93, 516, 679
BpiI GAAGAC 1 cut(s) 156
Bpu10I CCTNAGC 2 cut(s) 375, 648
BpuEI CTTGAG 2 cut(s) 174, 409
Bse118I RCCGGY 1 cut(s) 524
BseBI CCWGG 1 cut(s) 92
BseGI GGATG 3 cut(s) 108, 150, 507
BseMII CTCAG 1 cut(s) 366
BseXI GCAGC 2 cut(s) 289, 388
BshFI GGCC 2 cut(s) 28, 572
BsiSI CCGG 1 cut(s) 525
BslFI GGGAC 1 cut(s) 641
BsmFI GGGAC 1 cut(s) 641
BsnI GGCC 2 cut(s) 28, 572
Bsp1286I GDGCHC 1 cut(s) 190
Bsp1407I TGTACA 1 cut(s) 312
Bsp143I GATC 2 cut(s) 169, 556
BspACI CCGC 1 cut(s) 306
BspANI GGCC 2 cut(s) 28, 572
BspCNI CTCAG 1 cut(s) 367
BspHI TCATGA 1 cut(s) 60
BspLI GGNNCC 1 cut(s) 523
BsrFI RCCGGY 1 cut(s) 524
BsrGI TGTACA 1 cut(s) 312
BssAI RCCGGY 1 cut(s) 524
BssMI GATC 2 cut(s) 169, 556
Bst2UI CCWGG 1 cut(s) 92
BstAUI TGTACA 1 cut(s) 312
BstC8I GCNNGC 2 cut(s) 30, 234
BstDEI CTNAG 2 cut(s) 375, 648
BstF5I GGATG 3 cut(s) 108, 150, 507
BstKTI GATC 2 cut(s) 172, 559
BstMBI GATC 2 cut(s) 169, 556
BstMWI GCNNNNNNNGC 1 cut(s) 38
BstNI CCWGG 1 cut(s) 92
BstNSI RCATGY 1 cut(s) 440
BstSCI CCNGG 1 cut(s) 90
BstV1I GCAGC 2 cut(s) 289, 388
BstV2I GAAGAC 1 cut(s) 156
BstX2I RGATCY 1 cut(s) 556
BstXI CCANNNNNNTGG 1 cut(s) 98
BstYI RGATCY 1 cut(s) 556
BsuRI GGCC 2 cut(s) 28, 572
BtsCI GGATG 3 cut(s) 108, 150, 507
BtsI GCAGTG 1 cut(s) 385
BtsIMutI CAGTG 1 cut(s) 385
Cac8I GCNNGC 2 cut(s) 30, 234
CciI TCATGA 1 cut(s) 60
Cfr10I RCCGGY 1 cut(s) 524
Cfr13I GGNCC 3 cut(s) 26, 367, 570
Csp6I GTAC 1 cut(s) 313
CviAII CATG 6 cut(s) 61, 107, 113, 380, 437, 595
CviQI GTAC 1 cut(s) 313
DdeI CTNAG 2 cut(s) 375, 648
DpnI GATC 2 cut(s) 171, 558
DpnII GATC 2 cut(s) 169, 556
DraI TTTAAA 1 cut(s) 294
Eco24I GRGCYC 1 cut(s) 190
Eco32I GATATC 1 cut(s) 6
Eco47I GGWCC 1 cut(s) 367
EcoRII CCWGG 1 cut(s) 90
EcoRV GATATC 1 cut(s) 6
EcoT22I ATGCAT 1 cut(s) 108
EcoT38I GRGCYC 1 cut(s) 190
FaeI CATG 6 cut(s) 64, 110, 116, 383, 440, 598
FalI AAGNNNNNCTT 2 cut(s) 546, 578
FaqI GGGAC 1 cut(s) 641
FatI CATG 6 cut(s) 60, 106, 112, 379, 436, 594
Fnu4HI GCNGC 3 cut(s) 303, 306, 402
FokI GGATG 3 cut(s) 115, 157, 494
FriOI GRGCYC 1 cut(s) 190
Fsp4HI GCNGC 3 cut(s) 303, 306, 402
FspBI CTAG 2 cut(s) 591, 608
GluI GCNGC 3 cut(s) 303, 306, 402
HaeIII GGCC 2 cut(s) 28, 572
HapII CCGG 1 cut(s) 525
Hin1II CATG 6 cut(s) 64, 110, 116, 383, 440, 598
HpaII CCGG 1 cut(s) 525
HphI GGTGA 1 cut(s) 650
Hpy188I TCNGA 1 cut(s) 583
Hpy188III TCNNGA 4 cut(s) 44, 61, 139, 167
HpyF10VI GCNNNNNNNGC 1 cut(s) 38
HpyF3I CTNAG 2 cut(s) 375, 648
Hsp92II CATG 6 cut(s) 64, 110, 116, 383, 440, 598
Kzo9I GATC 2 cut(s) 169, 556
LmnI GCTCC 1 cut(s) 521
LpnPI CCDG 8 cut(s) 42, 77, 104, 180, 383, 387, 538, 658
Lsp1109I GCAGC 2 cut(s) 289, 388
LweI GCATC 3 cut(s) 93, 516, 679
MaeI CTAG 2 cut(s) 591, 608
MaeIII GTNAC 2 cut(s) 439, 638
MalI GATC 2 cut(s) 171, 558
MboI GATC 2 cut(s) 169, 556
MboII GAAGA 3 cut(s) 161, 262, 551
MfeI CAATTG 3 cut(s) 242, 270, 284
MflI RGATCY 1 cut(s) 556
MhlI GDGCHC 1 cut(s) 190
MluCI AATT 9 cut(s) 242, 270, 276, 284, 336, 344, 358, 405, 586
MnlI CCTC 3 cut(s) 31, 135, 478
Mph1103I ATGCAT 1 cut(s) 108
MseI TTAA 5 cut(s) 78, 204, 279, 293, 419
MslI CAYNNNNRTG 3 cut(s) 111, 294, 512
MspI CCGG 1 cut(s) 525
MspR9I CCNGG 1 cut(s) 92
MunI CAATTG 3 cut(s) 242, 270, 284
MvaI CCWGG 1 cut(s) 92
MwoI GCNNNNNNNGC 1 cut(s) 38
NdeII GATC 2 cut(s) 169, 556
NlaIII CATG 6 cut(s) 64, 110, 116, 383, 440, 598
NlaIV GGNNCC 1 cut(s) 523
NmuCI GTSAC 1 cut(s) 638
NsiI ATGCAT 1 cut(s) 108
NspI RCATGY 1 cut(s) 440
PagI TCATGA 1 cut(s) 60
PciI ACATGT 1 cut(s) 436
PkrI GCNGC 3 cut(s) 304, 307, 403
PscI ACATGT 1 cut(s) 436
PshBI ATTAAT 2 cut(s) 279, 419
Psp6I CCWGG 1 cut(s) 90
PspGI CCWGG 1 cut(s) 90
PspN4I GGNNCC 1 cut(s) 523
PspPI GGNCC 3 cut(s) 26, 367, 570
PsuI RGATCY 1 cut(s) 556
RsaI GTAC 1 cut(s) 314
RsaNI GTAC 1 cut(s) 313
RseI CAYNNNNRTG 3 cut(s) 111, 294, 512
SaqAI TTAA 5 cut(s) 78, 204, 279, 293, 419
SatI GCNGC 3 cut(s) 303, 306, 402
Sau3AI GATC 2 cut(s) 169, 556
Sau96I GGNCC 3 cut(s) 26, 367, 570
ScrFI CCNGG 1 cut(s) 92
SduI GDGCHC 1 cut(s) 190
SetI ASST 6 cut(s) 60, 304, 489, 609, 618, 649
SfaNI GCATC 3 cut(s) 93, 516, 679
SinI GGWCC 1 cut(s) 367
SmiI ATTTAAAT 1 cut(s) 294
SmiMI CAYNNNNRTG 3 cut(s) 111, 294, 512
SmlI CTYRAG 2 cut(s) 189, 424
SmoI CTYRAG 2 cut(s) 189, 424
Sse9I AATT 9 cut(s) 242, 270, 276, 284, 336, 344, 358, 405, 586
SsiI CCGC 1 cut(s) 306
SspMI CTAG 2 cut(s) 591, 608
StyD4I CCNGG 1 cut(s) 90
SwaI ATTTAAAT 1 cut(s) 294
TaqI TCGA 1 cut(s) 483
TasI AATT 9 cut(s) 242, 270, 276, 284, 336, 344, 358, 405, 586
TatI WGTACW 1 cut(s) 312
TauI GCSGC 1 cut(s) 308
Tru1I TTAA 5 cut(s) 78, 204, 279, 293, 419
Tru9I TTAA 5 cut(s) 78, 204, 279, 293, 419
TscAI CASTG 1 cut(s) 392
TseFI GTSAC 1 cut(s) 638
TseI GCWGC 2 cut(s) 302, 401
Tsp45I GTSAC 1 cut(s) 638
TspDTI ATGAA 4 cut(s) 8, 77, 312, 396
TspRI CASTG 1 cut(s) 392
VpaK11BI GGWCC 1 cut(s) 367
VspI ATTAAT 2 cut(s) 279, 419
XceI RCATGY 1 cut(s) 440
XspI CTAG 2 cut(s) 591, 608
Zsp2I ATGCAT 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.