Rmu_ssc0000432.1_g000117

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000432.1
Physical Location & Seq
Forward (+)
399378 .. 399845
468 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000432.1_g000117.1.cds

Sequence Viewer

Length: 468 bp
atgtctagtcaagattttcaatcggcttttgatggggtattgtgtgacatgattaagctctatgtcatgatttatagtgctttcaatgataatgctcggaatttgcttcatgatgacacatttggggtaatgggatctgtggcgagctctcttgttgatatgtatgcccactgtggaactttgaagaatgcatacaacatctataattgtgttagaaacaaaagtctaatattttggactaccatgatcaatgcgtatggcatgcatggtcatggcaagggagccattgatctattcgagacgatgcatgaccaaaagattgttcctgatcatattatgtttttggctcaagtctttgacattaaggggcaaatggaaactgatgatgggcttgcaaacaatttggagaagatatgtttgcttattgcaattgcaattattcaattgctaataattgcatttaaatga

Protein Analysis

155

Amino Acids

17.38

Weight (kDa)

5.31

Isoelectric Point (pI)

30.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 142
AcsI RAATTY 1 cut(s) 100
AgsI TTSAA 4 cut(s) 20, 85, 184, 443
AjuI GAANNNNNNNTTGG 2 cut(s) 306, 338
AluBI AGCT 2 cut(s) 58, 147
AluI AGCT 2 cut(s) 58, 147
Alw21I GWGCWC 1 cut(s) 149
Alw26I GTCTC 1 cut(s) 293
AlwI GGATC 1 cut(s) 142
ApoI RAATTY 1 cut(s) 100
BanII GRGCYC 1 cut(s) 149
BarI GAAGNNNNNNTAC 2 cut(s) 176, 208
Bbv12I GWGCWC 1 cut(s) 149
BccI CCATC 2 cut(s) 26, 380
BclI TGATCA 2 cut(s) 246, 328
BcoDI GTCTC 1 cut(s) 293
BfaI CTAG 1 cut(s) 6
BmiI GGNNCC 1 cut(s) 283
BmsI GCATC 1 cut(s) 294
BpuEI CTTGAG 1 cut(s) 333
BsiHKAI GWGCWC 1 cut(s) 149
BsmAI GTCTC 1 cut(s) 293
BsmBI CGTCTC 1 cut(s) 293
BsmI GAATGC 1 cut(s) 193
Bsp1286I GDGCHC 1 cut(s) 149
Bsp143I GATC 4 cut(s) 134, 246, 289, 328
BspHI TCATGA 2 cut(s) 66, 109
BspLI GGNNCC 1 cut(s) 283
BspPI GGATC 1 cut(s) 142
BssMI GATC 4 cut(s) 134, 246, 289, 328
Bst4CI ACNGT 1 cut(s) 173
BstC8I GCNNGC 3 cut(s) 145, 263, 393
BstKTI GATC 4 cut(s) 137, 249, 292, 331
BstMAI GTCTC 1 cut(s) 293
BstMBI GATC 4 cut(s) 134, 246, 289, 328
BstNSI RCATGY 1 cut(s) 265
BstX2I RGATCY 1 cut(s) 134
BstYI RGATCY 1 cut(s) 134
BtsIMutI CAGTG 1 cut(s) 169
Cac8I GCNNGC 3 cut(s) 145, 263, 393
CciI TCATGA 2 cut(s) 66, 109
CviAII CATG 8 cut(s) 49, 67, 110, 244, 262, 266, 272, 308
CviJI RGCY 6 cut(s) 26, 58, 147, 284, 347, 391
CviKI_1 RGCY 6 cut(s) 26, 58, 147, 284, 347, 391
DpnI GATC 4 cut(s) 136, 248, 291, 330
DpnII GATC 4 cut(s) 134, 246, 289, 328
DraI TTTAAA 1 cut(s) 463
Ecl136II GAGCTC 1 cut(s) 147
Eco24I GRGCYC 1 cut(s) 149
Eco53kI GAGCTC 1 cut(s) 147
EcoICRI GAGCTC 1 cut(s) 147
EcoT22I ATGCAT 3 cut(s) 193, 267, 309
EcoT38I GRGCYC 1 cut(s) 149
Esp3I CGTCTC 1 cut(s) 293
FaeI CATG 8 cut(s) 52, 70, 113, 247, 265, 269, 275, 311
FatI CATG 8 cut(s) 48, 66, 109, 243, 261, 265, 271, 307
FbaI TGATCA 2 cut(s) 246, 328
FriOI GRGCYC 1 cut(s) 149
FspBI CTAG 1 cut(s) 6
Hin1II CATG 8 cut(s) 52, 70, 113, 247, 265, 269, 275, 311
Hpy188I TCNGA 1 cut(s) 99
Hpy188III TCNNGA 5 cut(s) 11, 67, 110, 298, 326
HpyCH4III ACNGT 1 cut(s) 173
HpyCH4V TGCA 7 cut(s) 191, 265, 307, 395, 428, 434, 458
Hsp92II CATG 8 cut(s) 52, 70, 113, 247, 265, 269, 275, 311
Ksp22I TGATCA 2 cut(s) 246, 328
Kzo9I GATC 4 cut(s) 134, 246, 289, 328
LmnI GCTCC 1 cut(s) 281
LpnPI CCDG 1 cut(s) 339
LweI GCATC 1 cut(s) 294
MaeI CTAG 1 cut(s) 6
MaeIII GTNAC 1 cut(s) 44
MalI GATC 4 cut(s) 136, 248, 291, 330
MboI GATC 4 cut(s) 134, 246, 289, 328
MboII GAAGA 2 cut(s) 196, 421
MfeI CAATTG 2 cut(s) 429, 443
MflI RGATCY 1 cut(s) 134
MhlI GDGCHC 1 cut(s) 149
MluCI AATT 7 cut(s) 100, 205, 400, 429, 435, 443, 453
Mph1103I ATGCAT 3 cut(s) 193, 267, 309
MseI TTAA 3 cut(s) 54, 363, 462
MslI CAYNNNNRTG 2 cut(s) 270, 463
MunI CAATTG 2 cut(s) 429, 443
Mva1269I GAATGC 1 cut(s) 193
NdeII GATC 4 cut(s) 134, 246, 289, 328
NlaIII CATG 8 cut(s) 52, 70, 113, 247, 265, 269, 275, 311
NlaIV GGNNCC 1 cut(s) 283
NmuCI GTSAC 1 cut(s) 44
NsiI ATGCAT 3 cut(s) 193, 267, 309
NspI RCATGY 1 cut(s) 265
PaeI GCATGC 1 cut(s) 265
PagI TCATGA 2 cut(s) 66, 109
PctI GAATGC 1 cut(s) 193
Psp124BI GAGCTC 1 cut(s) 149
PspN4I GGNNCC 1 cut(s) 283
PsuI RGATCY 1 cut(s) 134
RseI CAYNNNNRTG 2 cut(s) 270, 463
SacI GAGCTC 1 cut(s) 149
SaqAI TTAA 3 cut(s) 54, 363, 462
Sau3AI GATC 4 cut(s) 134, 246, 289, 328
SduI GDGCHC 1 cut(s) 149
SetI ASST 2 cut(s) 60, 149
SfaNI GCATC 1 cut(s) 294
SmiI ATTTAAAT 1 cut(s) 463
SmiMI CAYNNNNRTG 2 cut(s) 270, 463
SmlI CTYRAG 1 cut(s) 348
SmoI CTYRAG 1 cut(s) 348
SphI GCATGC 1 cut(s) 265
Sse9I AATT 7 cut(s) 100, 205, 400, 429, 435, 443, 453
SspI AATATT 1 cut(s) 231
SspMI CTAG 1 cut(s) 6
SstI GAGCTC 1 cut(s) 149
SwaI ATTTAAAT 1 cut(s) 463
TaaI ACNGT 1 cut(s) 173
TaqI TCGA 1 cut(s) 297
TasI AATT 7 cut(s) 100, 205, 400, 429, 435, 443, 453
Tru1I TTAA 3 cut(s) 54, 363, 462
Tru9I TTAA 3 cut(s) 54, 363, 462
TscAI CASTG 1 cut(s) 176
TseFI GTSAC 1 cut(s) 44
Tsp45I GTSAC 1 cut(s) 44
TspDTI ATGAA 1 cut(s) 98
TspRI CASTG 1 cut(s) 176
XapI RAATTY 1 cut(s) 100
XceI RCATGY 1 cut(s) 265
XspI CTAG 1 cut(s) 6
Zsp2I ATGCAT 3 cut(s) 193, 267, 309
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.