Rmu_sc0025676.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0025676.1
Physical Location & Seq
Forward (+)
10 .. 720
711 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0025676.1_g000001.1.cds

Sequence Viewer

Length: 711 bp
atggatattagtaactcggggcttaagttggacatggaaacatatgatactctaatagaagcatctatgtctagtcaagattttcaatcggctttttctttgtttagggacatgagagaagcaagaacacttgacttaaagggtagttacctgaccattatgacaggcttaatggaaaatcaccggccagagttgatggcagctttcttagatgaggttgtggaggaccctcgaattgaagtgggtacccatgactggaattcaattattcatgccttttgtaaagctgggcgactagaagatgcgaggaggacttttagaaggatggtattcttgcagtataaacctaatgaccagacatatttgtcattaattagtgggtatgtttctgtggagaaatatttttgtgttttgatgctgtggcatgaggtgaagagaaacatttcagttgatggagagaaggggcttaaatttgatcacaacatggttgatgcattcctgtatgctcttgttaagggaggcttttttgatgcagtaatgcaagtcgtcgagaaatctcaagagatgaaaatctttgtggataaatggaggtacaagcaggcattcatggaaacccataagaagcttaaagtgtcaaagttgagaaagaggagtttcaggaaaatggaagcacttgttgctttcaagaattgggctggtctcaatgcatga

Protein Analysis

236

Amino Acids

27.58

Weight (kDa)

8.71

Isoelectric Point (pI)

36.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 364
Acc65I GGTACC 1 cut(s) 245
AccB1I GGYRCC 1 cut(s) 245
AcoI YGGCCR 1 cut(s) 185
AcsI RAATTY 2 cut(s) 259, 470
AfaI GTAC 2 cut(s) 247, 593
AfiI CCNNNNNNNGG 1 cut(s) 255
AflII CTTAAG 1 cut(s) 23
AgsI TTSAA 4 cut(s) 86, 239, 264, 685
AluBI AGCT 3 cut(s) 203, 287, 625
AluI AGCT 3 cut(s) 203, 287, 625
Alw26I GTCTC 1 cut(s) 704
Ama87I CYCGRG 1 cut(s) 16
AoxI GGCC 1 cut(s) 185
ApeKI GCWGC 1 cut(s) 200
ApoI RAATTY 2 cut(s) 259, 470
AseI ATTAAT 1 cut(s) 371
Asp700I GAANNNNTTC 1 cut(s) 442
Asp718I GGTACC 1 cut(s) 245
AspS9I GGNCC 1 cut(s) 226
AsuHPI GGTGA 2 cut(s) 173, 442
AvaI CYCGRG 1 cut(s) 16
AvaII GGWCC 1 cut(s) 226
BanI GGYRCC 1 cut(s) 245
BbvI GCAGC 1 cut(s) 212
BccI CCATC 3 cut(s) 190, 319, 446
BclI TGATCA 1 cut(s) 475
BcoDI GTCTC 1 cut(s) 704
BfaI CTAG 2 cut(s) 72, 296
BfrI CTTAAG 1 cut(s) 23
BisI GCNGC 1 cut(s) 201
BlsI GCNGC 1 cut(s) 202
Bme18I GGWCC 1 cut(s) 226
BmeT110I CYCGRG 1 cut(s) 16
BmgT120I GGNCC 1 cut(s) 226
BmiI GGNNCC 2 cut(s) 228, 247
BmsI GCATC 5 cut(s) 71, 292, 405, 481, 520
BpuEI CTTGAG 1 cut(s) 543
BsaBI GATNNNNATC 1 cut(s) 569
BsaI GGTCTC 1 cut(s) 704
Bsc4I CCNNNNNNNGG 1 cut(s) 255
Bse118I RCCGGY 1 cut(s) 183
Bse1I ACTGG 1 cut(s) 260
Bse8I GATNNNNATC 1 cut(s) 569
BseGI GGATG 1 cut(s) 330
BseJI GATNNNNATC 1 cut(s) 569
BseLI CCNNNNNNNGG 1 cut(s) 255
BseNI ACTGG 1 cut(s) 260
BseRI GAGGAG 2 cut(s) 322, 664
BseXI GCAGC 1 cut(s) 212
BseYI CCCAGC 1 cut(s) 287
BshFI GGCC 1 cut(s) 187
BshNI GGYRCC 1 cut(s) 245
BsiHKCI CYCGRG 1 cut(s) 16
BsiSI CCGG 1 cut(s) 184
BslFI GGGAC 1 cut(s) 122
BslI CCNNNNNNNGG 1 cut(s) 255
BsmAI GTCTC 1 cut(s) 704
BsmFI GGGAC 1 cut(s) 122
BsmI GAATGC 2 cut(s) 494, 602
BsnI GGCC 1 cut(s) 187
Bso31I GGTCTC 1 cut(s) 704
BsoBI CYCGRG 1 cut(s) 16
Bsp143I GATC 1 cut(s) 475
BspANI GGCC 1 cut(s) 187
BspLI GGNNCC 2 cut(s) 228, 247
BspT107I GGYRCC 1 cut(s) 245
BspTI CTTAAG 1 cut(s) 23
BspTNI GGTCTC 1 cut(s) 704
BsrFI RCCGGY 1 cut(s) 183
BsrI ACTGG 1 cut(s) 260
BssAI RCCGGY 1 cut(s) 183
BssMI GATC 1 cut(s) 475
Bst6I CTCTTC 1 cut(s) 428
BstAFI CTTAAG 1 cut(s) 23
BstAPI GCANNNNNTGC 1 cut(s) 677
BstC8I GCNNGC 1 cut(s) 600
BstDEI CTNAG 1 cut(s) 208
BstF5I GGATG 1 cut(s) 330
BstKTI GATC 1 cut(s) 478
BstMAI GTCTC 1 cut(s) 704
BstMBI GATC 1 cut(s) 475
BstMWI GCNNNNNNNGC 1 cut(s) 677
BstV1I GCAGC 1 cut(s) 212
BsuRI GGCC 1 cut(s) 187
BtsCI GGATG 1 cut(s) 330
Cac8I GCNNGC 1 cut(s) 600
Cfr10I RCCGGY 1 cut(s) 183
Cfr13I GGNCC 1 cut(s) 226
Csp6I GTAC 2 cut(s) 246, 592
CviAII CATG 8 cut(s) 34, 112, 251, 272, 425, 484, 607, 708
CviQI GTAC 2 cut(s) 246, 592
DdeI CTNAG 1 cut(s) 208
DpnI GATC 1 cut(s) 477
DpnII GATC 1 cut(s) 475
DrdI GACNNNNNNGTC 1 cut(s) 364
DseDI GACNNNNNNGTC 1 cut(s) 364
EaeI YGGCCR 1 cut(s) 185
Eam1104I CTCTTC 1 cut(s) 428
EarI CTCTTC 1 cut(s) 428
Eco31I GGTCTC 1 cut(s) 704
Eco47I GGWCC 1 cut(s) 226
Eco88I CYCGRG 1 cut(s) 16
EcoO109I RGGNCCY 1 cut(s) 226
EcoRI GAATTC 1 cut(s) 259
EcoT22I ATGCAT 2 cut(s) 496, 709
FaeI CATG 8 cut(s) 37, 115, 254, 275, 428, 487, 610, 711
FalI AAGNNNNNCTT 2 cut(s) 506, 538
FaqI GGGAC 1 cut(s) 122
FatI CATG 8 cut(s) 33, 111, 250, 271, 424, 483, 606, 707
FauNDI CATATG 1 cut(s) 43
FbaI TGATCA 1 cut(s) 475
Fnu4HI GCNGC 1 cut(s) 201
FokI GGATG 1 cut(s) 337
Fsp4HI GCNGC 1 cut(s) 201
FspBI CTAG 2 cut(s) 72, 296
GluI GCNGC 1 cut(s) 201
GsaI CCCAGC 1 cut(s) 291
HaeIII GGCC 1 cut(s) 187
HapII CCGG 1 cut(s) 184
Hin1II CATG 8 cut(s) 37, 115, 254, 275, 428, 487, 610, 711
HindIII AAGCTT 1 cut(s) 623
HpaII CCGG 1 cut(s) 184
HphI GGTGA 2 cut(s) 173, 442
Hpy188III TCNNGA 5 cut(s) 77, 550, 560, 658, 685
Hpy99I CGWCG 1 cut(s) 551
HpyAV CCTTC 2 cut(s) 315, 454
HpyCH4V TGCA 5 cut(s) 337, 494, 533, 541, 707
HpyF10VI GCNNNNNNNGC 1 cut(s) 677
HpyF3I CTNAG 1 cut(s) 208
Hsp92II CATG 8 cut(s) 37, 115, 254, 275, 428, 487, 610, 711
KpnI GGTACC 1 cut(s) 249
Ksp22I TGATCA 1 cut(s) 475
Kzo9I GATC 1 cut(s) 475
Lsp1109I GCAGC 1 cut(s) 212
LweI GCATC 5 cut(s) 71, 292, 405, 481, 520
MaeI CTAG 2 cut(s) 72, 296
MaeIII GTNAC 2 cut(s) 11, 146
MalI GATC 1 cut(s) 477
MboI GATC 1 cut(s) 475
MboII GAAGA 2 cut(s) 311, 445
MluCI AATT 6 cut(s) 234, 259, 264, 372, 470, 688
MmeI TCCRAC 1 cut(s) 9
MnlI CCTC 9 cut(s) 208, 217, 240, 300, 303, 421, 512, 582, 642
Mph1103I ATGCAT 2 cut(s) 496, 709
MroXI GAANNNNTTC 1 cut(s) 442
MseI TTAA 7 cut(s) 24, 137, 170, 371, 468, 513, 627
MspCI CTTAAG 1 cut(s) 23
MspI CCGG 1 cut(s) 184
Mva1269I GAATGC 2 cut(s) 494, 602
MwoI GCNNNNNNNGC 1 cut(s) 677
NdeI CATATG 1 cut(s) 43
NdeII GATC 1 cut(s) 475
NlaIII CATG 8 cut(s) 37, 115, 254, 275, 428, 487, 610, 711
NlaIV GGNNCC 2 cut(s) 228, 247
NsiI ATGCAT 2 cut(s) 496, 709
PctI GAATGC 2 cut(s) 494, 602
PdmI GAANNNNTTC 1 cut(s) 442
PkrI GCNGC 1 cut(s) 202
PpuMI RGGWCCY 1 cut(s) 226
PshBI ATTAAT 1 cut(s) 371
Psp5II RGGWCCY 1 cut(s) 226
PspFI CCCAGC 1 cut(s) 287
PspN4I GGNNCC 2 cut(s) 228, 247
PspPI GGNCC 1 cut(s) 226
PspPPI RGGWCCY 1 cut(s) 226
RsaI GTAC 2 cut(s) 247, 593
RsaNI GTAC 2 cut(s) 246, 592
SaqAI TTAA 7 cut(s) 24, 137, 170, 371, 468, 513, 627
SatI GCNGC 1 cut(s) 201
Sau3AI GATC 1 cut(s) 475
Sau96I GGNCC 1 cut(s) 226
SetI ASST 8 cut(s) 153, 205, 219, 289, 349, 432, 593, 627
SfaNI GCATC 5 cut(s) 71, 292, 405, 481, 520
SinI GGWCC 1 cut(s) 226
SmlI CTYRAG 2 cut(s) 23, 558
SmoI CTYRAG 2 cut(s) 23, 558
Sse9I AATT 6 cut(s) 234, 259, 264, 372, 470, 688
SspI AATATT 1 cut(s) 401
SspMI CTAG 2 cut(s) 72, 296
TaqI TCGA 2 cut(s) 232, 549
TasI AATT 6 cut(s) 234, 259, 264, 372, 470, 688
Tru1I TTAA 7 cut(s) 24, 137, 170, 371, 468, 513, 627
Tru9I TTAA 7 cut(s) 24, 137, 170, 371, 468, 513, 627
TseI GCWGC 1 cut(s) 200
TspDTI ATGAA 3 cut(s) 260, 581, 595
Vha464I CTTAAG 1 cut(s) 23
VpaK11BI GGWCC 1 cut(s) 226
VspI ATTAAT 1 cut(s) 371
XapI RAATTY 2 cut(s) 259, 470
XmnI GAANNNNTTC 1 cut(s) 442
XspI CTAG 2 cut(s) 72, 296
Zsp2I ATGCAT 2 cut(s) 496, 709
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.