Rmu_sc0022931.1_g000002

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0022931.1
Physical Location & Seq
Forward (+)
3161 .. 3670
510 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0022931.1_g000002.1.cds

Sequence Viewer

Length: 510 bp
atggatattagtaactcggagcttaagttggacatggaaacatattatactctaatagaagcatctatgtctagtcaagattttcaatcggcttttgatggggtattgtgggacttgattaagctctttgtcatgatttatagtgctctcaatgataatgctcggaatttgcttcatgatgacacatttggggtaatgggatatgttgcaagctctcttgttgatatgtatgcccactgtggaactttgaagaatgcatacaatatatataattgtgttagaaacaaaagtctaattttttggactaccatgatcaatgcgtatgggatgcatggtcatggcaaggaagccatttatttattcgagatgatgcatgaccaaaagattgtttttgatcatatttcgtttttggctcaagtctttgacattaagggtcaaatggaaactgatgatgagcttgcaaacaatttggagaaaatatgtttgcttattgcaattgcatttaaatga

Protein Analysis

169

Amino Acids

19.37

Weight (kDa)

4.72

Isoelectric Point (pI)

32.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 166
AflII CTTAAG 1 cut(s) 23
AgsI TTSAA 2 cut(s) 86, 250
AluBI AGCT 4 cut(s) 22, 124, 213, 457
AluI AGCT 4 cut(s) 22, 124, 213, 457
Alw21I GWGCWC 1 cut(s) 148
ApoI RAATTY 1 cut(s) 166
BarI GAAGNNNNNNTAC 2 cut(s) 242, 274
Bbv12I GWGCWC 1 cut(s) 148
BccI CCATC 1 cut(s) 92
BclI TGATCA 2 cut(s) 312, 394
BfaI CTAG 1 cut(s) 72
BfrI CTTAAG 1 cut(s) 23
BmsI GCATC 3 cut(s) 71, 318, 360
BpuEI CTTGAG 1 cut(s) 399
BsaXI ACNNNNNCTCC 2 cut(s) 11, 41
BseGI GGATG 1 cut(s) 333
BsiHKAI GWGCWC 1 cut(s) 148
BslFI GGGAC 1 cut(s) 125
BsmFI GGGAC 1 cut(s) 125
BsmI GAATGC 1 cut(s) 259
Bsp1286I GDGCHC 1 cut(s) 148
Bsp143I GATC 2 cut(s) 312, 394
BspHI TCATGA 2 cut(s) 132, 175
BspTI CTTAAG 1 cut(s) 23
BssMI GATC 2 cut(s) 312, 394
Bst4CI ACNGT 1 cut(s) 239
BstAFI CTTAAG 1 cut(s) 23
BstC8I GCNNGC 2 cut(s) 211, 459
BstF5I GGATG 1 cut(s) 333
BstKTI GATC 2 cut(s) 315, 397
BstMBI GATC 2 cut(s) 312, 394
BtsCI GGATG 1 cut(s) 333
BtsIMutI CAGTG 1 cut(s) 235
Cac8I GCNNGC 2 cut(s) 211, 459
CciI TCATGA 2 cut(s) 132, 175
CviAII CATG 7 cut(s) 34, 133, 176, 310, 332, 338, 374
CviJI RGCY 7 cut(s) 22, 92, 124, 213, 350, 413, 457
CviKI_1 RGCY 7 cut(s) 22, 92, 124, 213, 350, 413, 457
DpnI GATC 2 cut(s) 314, 396
DpnII GATC 2 cut(s) 312, 394
DraI TTTAAA 1 cut(s) 505
EcoT22I ATGCAT 3 cut(s) 259, 333, 375
FaeI CATG 7 cut(s) 37, 136, 179, 313, 335, 341, 377
FaqI GGGAC 1 cut(s) 125
FatI CATG 7 cut(s) 33, 132, 175, 309, 331, 337, 373
FbaI TGATCA 2 cut(s) 312, 394
FokI GGATG 1 cut(s) 340
FspBI CTAG 1 cut(s) 72
Hin1II CATG 7 cut(s) 37, 136, 179, 313, 335, 341, 377
Hpy188I TCNGA 2 cut(s) 19, 165
Hpy188III TCNNGA 4 cut(s) 77, 133, 176, 364
HpyCH4III ACNGT 1 cut(s) 239
HpyCH4V TGCA 7 cut(s) 209, 257, 331, 373, 461, 494, 500
Hsp92II CATG 7 cut(s) 37, 136, 179, 313, 335, 341, 377
Ksp22I TGATCA 2 cut(s) 312, 394
Kzo9I GATC 2 cut(s) 312, 394
LmnI GCTCC 1 cut(s) 19
LweI GCATC 3 cut(s) 71, 318, 360
MaeI CTAG 1 cut(s) 72
MaeIII GTNAC 1 cut(s) 11
MalI GATC 2 cut(s) 314, 396
MboI GATC 2 cut(s) 312, 394
MboII GAAGA 1 cut(s) 262
MfeI CAATTG 1 cut(s) 495
MhlI GDGCHC 1 cut(s) 148
MluCI AATT 5 cut(s) 166, 271, 294, 466, 495
MmeI TCCRAC 1 cut(s) 9
Mph1103I ATGCAT 3 cut(s) 259, 333, 375
MseI TTAA 4 cut(s) 24, 120, 429, 504
MslI CAYNNNNRTG 2 cut(s) 336, 505
MspCI CTTAAG 1 cut(s) 23
MunI CAATTG 1 cut(s) 495
Mva1269I GAATGC 1 cut(s) 259
NdeII GATC 2 cut(s) 312, 394
NlaIII CATG 7 cut(s) 37, 136, 179, 313, 335, 341, 377
NsiI ATGCAT 3 cut(s) 259, 333, 375
PagI TCATGA 2 cut(s) 132, 175
PctI GAATGC 1 cut(s) 259
RseI CAYNNNNRTG 2 cut(s) 336, 505
SaqAI TTAA 4 cut(s) 24, 120, 429, 504
Sau3AI GATC 2 cut(s) 312, 394
SduI GDGCHC 1 cut(s) 148
SetI ASST 4 cut(s) 24, 126, 215, 459
SfaNI GCATC 3 cut(s) 71, 318, 360
SmiI ATTTAAAT 1 cut(s) 505
SmiMI CAYNNNNRTG 2 cut(s) 336, 505
SmlI CTYRAG 2 cut(s) 23, 414
SmoI CTYRAG 2 cut(s) 23, 414
Sse9I AATT 5 cut(s) 166, 271, 294, 466, 495
SspMI CTAG 1 cut(s) 72
SwaI ATTTAAAT 1 cut(s) 505
TaaI ACNGT 1 cut(s) 239
TaqI TCGA 1 cut(s) 363
TasI AATT 5 cut(s) 166, 271, 294, 466, 495
Tru1I TTAA 4 cut(s) 24, 120, 429, 504
Tru9I TTAA 4 cut(s) 24, 120, 429, 504
TscAI CASTG 1 cut(s) 242
TspDTI ATGAA 1 cut(s) 164
TspRI CASTG 1 cut(s) 242
Vha464I CTTAAG 1 cut(s) 23
XapI RAATTY 1 cut(s) 166
XspI CTAG 1 cut(s) 72
Zsp2I ATGCAT 3 cut(s) 259, 333, 375
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.