Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012743.1

Orthogroup ID

OG0001893

Physical Location & Seq

Genomic Coordinates Reverse (-)

12721 .. 13867

Gene Structure 1147 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012743.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 519 bp

atgcggcattggctgagggcagatatcctgtccgttgatgctaaagtgtcatctatcgtcttggataaaaccactaaagctgccggtgacattctgaaggtcttgcctctgtctgcccatactgtaaaagcagctgcttcaaaattcctattgaattggttggtccagcctgagcatgaacaccgcaaatggtctgctgcaatttctcttggattaatctcaagtcgcctacatgttactgatcataagcagaaggttgggaatatcgcgagacttgttgaggtgatgtgtagtagcaaaaggacccttgtcaaaggagcctgtggggttggcatggggttttcttgccaagatcttcttaccaggggtgatgctgctgataattctagcacggtgaaagactcagacaagttgtcagaaagggatttgcttggtgacatagttaaggcattattatgtgtgctaagtgagatcactcatgtggctcctgatattttggaaagcctctcatatttctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF3730

Protein Analysis

172

Amino Acids

18.71

Weight (kDa)

8.69

Isoelectric Point (pI)

30.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001893)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G68980 AT1G69290
fragaria_vesca	FvH4_4g15871 FvH4_4g30080 FvH4_5g31861
malus_domestica	MD13G1062900.v1.1 MD16G1061200.v1.1
prunus_persica	Prupe.1G286800_v2.0.a1
pyrus_communis	pycom13g05530 pycom16g05360
rosa_chinensis	RchiOBHm_Chr4g0438351 RchiOBHm_Chr5g0081041 RchiOBHm_Chr5g0081051
rosa_laevigata	RLG00000006368 RLG00000009184 RLG00000022150 RLG00000029496 RLG00000029523
rosa_multiflora	Rmu_co8205326.1_g000001 Rmu_co8209074.1_g000001 Rmu_co8210450.1_g000001 Rmu_sc0000029.1_g000033 Rmu_sc0000331.1_g000016 Rmu_sc0000718.1_g000024 Rmu_sc0002327.1_g000027 Rmu_sc0002541.1_g000004 Rmu_sc0006274.1_g000003 Rmu_sc0006274.1_g000004 Rmu_sc0007103.1_g000005 Rmu_sc0011176.1_g000001 Rmu_sc0012743.1_g000002 Rmu_sc0022931.1_g000002 Rmu_sc0025676.1_g000001 Rmu_sc0026128.1_g000001 Rmu_ssc0000432.1_g000117
rosa_roxburghii	Rroxscaffold_1G00002450 Rroxscaffold_2G00085350 Rroxscaffold_3G00249820
rosa_rugosa	Rorug04G0309200 Rorug06G0034900
rosa_samantha	Rh4AG360300 Rh4BG371200 Rh4CG385200 Rh4DG366100
rosa_wichuraiana	Rw0G006490 Rw0G016440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	269
AciI	CCGC	2 cut(s)	4, 184
AcsI	RAATTY	1 cut(s)	143
AcuI	CTGAAG	1 cut(s)	116
AflIII	ACRYGT	1 cut(s)	232
AgsI	TTSAA	2 cut(s)	141, 154
AhdI	GACNNNNNGTC	1 cut(s)	412
AjnI	CCWGG	1 cut(s)	362
AleI	CACNNNNGTG	1 cut(s)	479
AluBI	AGCT	2 cut(s)	80, 134
AluI	AGCT	2 cut(s)	80, 134
Alw26I	GTCTC	1 cut(s)	265
ApeKI	GCWGC	5 cut(s)	80, 131, 134, 197, 374
ApoI	RAATTY	1 cut(s)	143
AseI	ATTAAT	1 cut(s)	215
AspS9I	GGNCC	2 cut(s)	163, 303
AsuHPI	GGTGA	5 cut(s)	98, 295, 380, 406, 446
AvaII	GGWCC	2 cut(s)	163, 303
BbvCI	CCTCAGC	1 cut(s)	14
BbvI	GCAGC	5 cut(s)	67, 121, 143, 184, 361
BciT130I	CCWGG	1 cut(s)	364
BclI	TGATCA	1 cut(s)	241
BcoDI	GTCTC	1 cut(s)	265
BfaI	CTAG	1 cut(s)	387
BglII	AGATCT	1 cut(s)	352
BisI	GCNGC	6 cut(s)	5, 81, 132, 135, 198, 375
BlsI	GCNGC	6 cut(s)	6, 82, 133, 136, 199, 376
Bme1390I	CCNGG	1 cut(s)	364
Bme18I	GGWCC	2 cut(s)	163, 303
BmeRI	GACNNNNNGTC	1 cut(s)	412
BmgT120I	GGNCC	2 cut(s)	163, 303
BmiI	GGNNCC	3 cut(s)	305, 319, 486
BmrFI	CCNGG	1 cut(s)	364
BmsI	GCATC	2 cut(s)	28, 361
BoxI	GACNNNNGTC	1 cut(s)	308
Bpu10I	CCTNAGC	2 cut(s)	14, 171
BpuEI	CTTGAG	1 cut(s)	205
BsaJI	CCNNGG	1 cut(s)	363
Bse118I	RCCGGY	1 cut(s)	83
BseBI	CCWGG	1 cut(s)	364
BseDI	CCNNGG	1 cut(s)	363
BseMII	CTCAG	3 cut(s)	5, 162, 417
BseXI	GCAGC	5 cut(s)	67, 121, 143, 184, 361
Bsh1236I	CGCG	1 cut(s)	269
BsiSI	CCGG	1 cut(s)	84
BsmAI	GTCTC	1 cut(s)	265
Bsp143I	GATC	3 cut(s)	241, 352, 471
Bsp68I	TCGCGA	1 cut(s)	269
BspACI	CCGC	2 cut(s)	4, 184
BspCNI	CTCAG	3 cut(s)	6, 163, 416
BspFNI	CGCG	1 cut(s)	269
BspLI	GGNNCC	3 cut(s)	305, 319, 486
BsrFI	RCCGGY	1 cut(s)	83
BssAI	RCCGGY	1 cut(s)	83
BssECI	CCNNGG	1 cut(s)	363
BssMI	GATC	3 cut(s)	241, 352, 471
Bst2UI	CCWGG	1 cut(s)	364
Bst4CI	ACNGT	2 cut(s)	124, 394
BstDEI	CTNAG	4 cut(s)	14, 171, 403, 464
BstFNI	CGCG	1 cut(s)	269
BstKTI	GATC	3 cut(s)	244, 355, 474
BstMAI	GTCTC	1 cut(s)	265
BstMBI	GATC	3 cut(s)	241, 352, 471
BstMWI	GCNNNNNNNGC	1 cut(s)	10
BstNI	CCWGG	1 cut(s)	364
BstNSI	RCATGY	1 cut(s)	236
BstPAI	GACNNNNGTC	1 cut(s)	308
BstSCI	CCNGG	1 cut(s)	362
BstUI	CGCG	1 cut(s)	269
BstV1I	GCAGC	5 cut(s)	67, 121, 143, 184, 361
BstX2I	RGATCY	1 cut(s)	352
BstYI	RGATCY	1 cut(s)	352
BtuMI	TCGCGA	1 cut(s)	269
Cfr10I	RCCGGY	1 cut(s)	83
Cfr13I	GGNCC	2 cut(s)	163, 303
CviAII	CATG	4 cut(s)	176, 233, 334, 479
CviJI	RGCY	7 cut(s)	13, 80, 134, 169, 320, 485, 504
CviKI_1	RGCY	7 cut(s)	13, 80, 134, 169, 320, 485, 504
DdeI	CTNAG	4 cut(s)	14, 171, 403, 464
DpnI	GATC	3 cut(s)	243, 354, 473
DpnII	GATC	3 cut(s)	241, 352, 471
DriI	GACNNNNNGTC	1 cut(s)	412
Eam1105I	GACNNNNNGTC	1 cut(s)	412
Eco32I	GATATC	1 cut(s)	25
Eco47I	GGWCC	2 cut(s)	163, 303
Eco57I	CTGAAG	1 cut(s)	116
EcoO109I	RGGNCCY	1 cut(s)	303
EcoRII	CCWGG	1 cut(s)	362
EcoRV	GATATC	1 cut(s)	25
FaeI	CATG	4 cut(s)	179, 236, 337, 482
FaiI	YATR	9 cut(s)	120, 177, 234, 246, 335, 440, 457, 480, 511
FalI	AAGNNNNNCTT	2 cut(s)	342, 374
FatI	CATG	4 cut(s)	175, 232, 333, 478
FbaI	TGATCA	1 cut(s)	241
Fnu4HI	GCNGC	6 cut(s)	5, 81, 132, 135, 198, 375
Fsp4HI	GCNGC	6 cut(s)	5, 81, 132, 135, 198, 375
FspBI	CTAG	1 cut(s)	387
GluI	GCNGC	6 cut(s)	5, 81, 132, 135, 198, 375
HapII	CCGG	1 cut(s)	84
Hin1II	CATG	4 cut(s)	179, 236, 337, 482
HinfI	GANTC	1 cut(s)	401
HpaII	CCGG	1 cut(s)	84
HphI	GGTGA	5 cut(s)	98, 295, 380, 406, 446
Hpy188I	TCNGA	3 cut(s)	96, 406, 418
Hpy188III	TCNNGA	2 cut(s)	268, 488
HpyAV	CCTTC	2 cut(s)	91, 247
HpyCH4III	ACNGT	2 cut(s)	124, 394
HpyCH4V	TGCA	1 cut(s)	200
HpyF10VI	GCNNNNNNNGC	1 cut(s)	10
HpyF3I	CTNAG	4 cut(s)	14, 171, 403, 464
Hsp92II	CATG	4 cut(s)	179, 236, 337, 482
Ksp22I	TGATCA	1 cut(s)	241
Kzo9I	GATC	3 cut(s)	241, 352, 471
LmnI	GCTCC	2 cut(s)	317, 490
LpnPI	CCDG	8 cut(s)	41, 97, 179, 183, 334, 349, 376, 501
Lsp1109I	GCAGC	5 cut(s)	67, 121, 143, 184, 361
LweI	GCATC	2 cut(s)	28, 361
MaeI	CTAG	1 cut(s)	387
MaeIII	GTNAC	3 cut(s)	86, 235, 434
MalI	GATC	3 cut(s)	243, 354, 473
MboI	GATC	3 cut(s)	241, 352, 471
MboII	GAAGA	1 cut(s)	347
MflI	RGATCY	1 cut(s)	352
MluCI	AATT	4 cut(s)	143, 154, 201, 382
MlyI	GAGTC	1 cut(s)	395
MnlI	CCTC	4 cut(s)	9, 117, 274, 515
MseI	TTAA	2 cut(s)	215, 444
MslI	CAYNNNNRTG	2 cut(s)	454, 479
MspA1I	CMGCKG	1 cut(s)	134
MspI	CCGG	1 cut(s)	84
MspR9I	CCNGG	1 cut(s)	364
MvaI	CCWGG	1 cut(s)	364
MvnI	CGCG	1 cut(s)	269
MwoI	GCNNNNNNNGC	1 cut(s)	10
NdeII	GATC	3 cut(s)	241, 352, 471
NlaIII	CATG	4 cut(s)	179, 236, 337, 482
NlaIV	GGNNCC	3 cut(s)	305, 319, 486
NmuCI	GTSAC	2 cut(s)	86, 434
NruI	TCGCGA	1 cut(s)	269
NspI	RCATGY	1 cut(s)	236
OliI	CACNNNNGTG	1 cut(s)	479
PciI	ACATGT	1 cut(s)	232
PkrI	GCNGC	6 cut(s)	6, 82, 133, 136, 199, 376
PleI	GAGTC	1 cut(s)	395
PpsI	GAGTC	1 cut(s)	395
PpuMI	RGGWCCY	1 cut(s)	303
PscI	ACATGT	1 cut(s)	232
PshAI	GACNNNNGTC	1 cut(s)	308
PshBI	ATTAAT	1 cut(s)	215
Psp5II	RGGWCCY	1 cut(s)	303
Psp6I	CCWGG	1 cut(s)	362
PspGI	CCWGG	1 cut(s)	362
PspN4I	GGNNCC	3 cut(s)	305, 319, 486
PspPI	GGNCC	2 cut(s)	163, 303
PspPPI	RGGWCCY	1 cut(s)	303
PsuI	RGATCY	1 cut(s)	352
PvuII	CAGCTG	1 cut(s)	134
RruI	TCGCGA	1 cut(s)	269
RseI	CAYNNNNRTG	2 cut(s)	454, 479
SaqAI	TTAA	2 cut(s)	215, 444
SatI	GCNGC	6 cut(s)	5, 81, 132, 135, 198, 375
Sau3AI	GATC	3 cut(s)	241, 352, 471
Sau96I	GGNCC	2 cut(s)	163, 303
SchI	GAGTC	1 cut(s)	395
ScrFI	CCNGG	1 cut(s)	364
SetI	ASST	5 cut(s)	82, 102, 136, 258, 285
SfaNI	GCATC	2 cut(s)	28, 361
SinI	GGWCC	2 cut(s)	163, 303
SmiMI	CAYNNNNRTG	2 cut(s)	454, 479
SmlI	CTYRAG	1 cut(s)	220
SmoI	CTYRAG	1 cut(s)	220
Sse9I	AATT	4 cut(s)	143, 154, 201, 382
SsiI	CCGC	2 cut(s)	4, 184
SspMI	CTAG	1 cut(s)	387
StyD4I	CCNGG	1 cut(s)	362
TaaI	ACNGT	2 cut(s)	124, 394
TasI	AATT	4 cut(s)	143, 154, 201, 382
TauI	GCSGC	1 cut(s)	7
Tru1I	TTAA	2 cut(s)	215, 444
Tru9I	TTAA	2 cut(s)	215, 444
TseFI	GTSAC	2 cut(s)	86, 434
TseI	GCWGC	5 cut(s)	80, 131, 134, 197, 374
Tsp45I	GTSAC	2 cut(s)	86, 434
TspDTI	ATGAA	1 cut(s)	192
TspGWI	ACGGA	1 cut(s)	22
VpaK11BI	GGWCC	2 cut(s)	163, 303
VspI	ATTAAT	1 cut(s)	215
XapI	RAATTY	1 cut(s)	143
XceI	RCATGY	1 cut(s)	236
XspI	CTAG	1 cut(s)	387

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.