Rmu_sc0007103.1_g000005

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007103.1
Physical Location & Seq
Reverse (-)
23019 .. 24230
1212 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007103.1_g000005.1.cds

Sequence Viewer

Length: 1212 bp
atgaatgctcagggaggtattttggggcttgatgtgcatgtatcaatattgaatgctctttgcaaggtgcataggactgctgaagccactcaactggttatggatattagtaacttgaagcttaagttggacatggaaacatatgatactctaatagaagcatctatgtctagtcaagattttcaatcagcttttgatggggcattatgtgacttgattaagctttatgtcatgatttatagtgccttcaatgataatgctgggaatttgcttcatgattacacatttgggataatggaatctgttgcgagctctcttgttgatatgtatgcccactgtggaactttgaagaatgcatacaacatatataattgtgttagaaacaaaagcctaattttttggactaccatgatcaatgtgtatgggatgcatggacatggcaagggagccattgatttattcgagaggatgcatgaccaaaagattgttcctgatcatattatgtttttggctcaagtctttgacattaagggtcaaatggaaacttatgatgggtttgcaaacaatttggagaagatgtgtttgcttattgctggtaggtttgatagaatggaaggaaatgcaagagtaatgttggatgacatttggggaagatggaaatctttagtaattgctgcaaataatgagaattgtactgaagagttgcatgtaatttttcttgaaaaccatatggagctatttgcaaagtgcttgggacatgtgaagtctacctttgctgctcttcatataatgcagaagttgggattcaaacccaattacccgaattgccttaagttattcccaccttatgttagtgtatttgttgtgaataagattcattttgtgattgaacatccattgattgatgaagactattatgcacgtgttaaggggagacaaatcacctccaatcttagtaaagtttctgcagttgcattttatatcttctttgagaatctaaatgcagaagttgttgctggaattattgggaacaagcaagacgttgttgatcaccttacatggaccttcttgtacaagaggctcactcaaaatcccagctattataatcttcagggagttattcagaggcatccgtctgattacctctcaaagcttattgaaaatacattgactgacttggagacaatcaaagaagatgttgaggaatcatga

Protein Analysis

403

Amino Acids

45.91

Weight (kDa)

5.63

Isoelectric Point (pI)

34.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1104
AccI GTMKAC 1 cut(s) 767
AcsI RAATTY 1 cut(s) 265
AcuI CTGAAG 3 cut(s) 102, 717, 1094
AcvI CACGTG 1 cut(s) 923
AfaI GTAC 2 cut(s) 694, 1073
AflII CTTAAG 2 cut(s) 122, 830
AflIII ACRYGT 2 cut(s) 757, 922
AgsI TTSAA 9 cut(s) 52, 118, 185, 250, 349, 722, 808, 890, 1160
AjuI GAANNNNNNNTTGG 4 cut(s) 110, 142, 471, 503
AluBI AGCT 7 cut(s) 121, 191, 223, 312, 736, 1098, 1153
AluI AGCT 7 cut(s) 121, 191, 223, 312, 736, 1098, 1153
Alw21I GWGCWC 1 cut(s) 314
Alw26I GTCTC 2 cut(s) 928, 1175
ApeKI GCWGC 2 cut(s) 674, 776
ApoI RAATTY 1 cut(s) 265
AspS9I GGNCC 1 cut(s) 1062
AsuHPI GGTGA 2 cut(s) 934, 1043
AvaII GGWCC 1 cut(s) 1062
BanII GRGCYC 1 cut(s) 314
BarI GAAGNNNNNNTAC 2 cut(s) 341, 373
BbrPI CACGTG 1 cut(s) 923
BbsI GAAGAC 1 cut(s) 915
Bbv12I GWGCWC 1 cut(s) 314
BbvI GCAGC 2 cut(s) 661, 763
BccI CCATC 3 cut(s) 191, 545, 648
BclI TGATCA 3 cut(s) 411, 493, 1048
BcoDI GTCTC 2 cut(s) 928, 1175
BfaI CTAG 1 cut(s) 171
BfmI CTRYAG 1 cut(s) 966
BfrI CTTAAG 2 cut(s) 122, 830
BisI GCNGC 2 cut(s) 675, 777
BlsI GCNGC 2 cut(s) 676, 778
Bme18I GGWCC 1 cut(s) 1062
BmgT120I GGNCC 1 cut(s) 1062
BmiI GGNNCC 1 cut(s) 448
BmsI GCATC 4 cut(s) 170, 417, 459, 1138
BpiI GAAGAC 1 cut(s) 915
BplI GAGNNNNNCTC 2 cut(s) 1069, 1101
Bpu10I CCTNAGC 1 cut(s) 9
BpuEI CTTGAG 1 cut(s) 498
BsaAI YACGTR 1 cut(s) 923
BsaBI GATNNNNATC 1 cut(s) 658
BsaXI ACNNNNNCTCC 2 cut(s) 563, 593
Bse1I ACTGG 1 cut(s) 99
Bse8I GATNNNNATC 1 cut(s) 658
BseGI GGATG 5 cut(s) 432, 474, 643, 892, 1129
BseJI GATNNNNATC 1 cut(s) 658
BseMII CTCAG 1 cut(s) 23
BseNI ACTGG 1 cut(s) 99
BseXI GCAGC 2 cut(s) 661, 763
BseYI CCCAGC 2 cut(s) 260, 1094
BsiHKAI GWGCWC 1 cut(s) 314
BslFI GGGAC 1 cut(s) 768
BsmAI GTCTC 2 cut(s) 928, 1175
BsmFI GGGAC 1 cut(s) 768
BsmI GAATGC 3 cut(s) 10, 58, 358
Bsp1286I GDGCHC 1 cut(s) 314
Bsp1407I TGTACA 1 cut(s) 1071
Bsp143I GATC 3 cut(s) 411, 493, 1048
BspCNI CTCAG 1 cut(s) 22
BspHI TCATGA 3 cut(s) 231, 274, 1208
BspLI GGNNCC 1 cut(s) 448
BspMAI CTGCAG 1 cut(s) 970
BspQI GCTCTTC 1 cut(s) 786
BspTI CTTAAG 2 cut(s) 122, 830
BsrGI TGTACA 1 cut(s) 1071
BsrI ACTGG 1 cut(s) 99
BssMI GATC 3 cut(s) 411, 493, 1048
Bst4CI ACNGT 1 cut(s) 338
Bst6I CTCTTC 2 cut(s) 693, 786
BstAFI CTTAAG 2 cut(s) 122, 830
BstAUI TGTACA 1 cut(s) 1071
BstBAI YACGTR 1 cut(s) 923
BstC8I GCNNGC 1 cut(s) 310
BstDEI CTNAG 2 cut(s) 9, 953
BstF5I GGATG 5 cut(s) 432, 474, 643, 892, 1129
BstKTI GATC 3 cut(s) 414, 496, 1051
BstMAI GTCTC 2 cut(s) 928, 1175
BstMBI GATC 3 cut(s) 411, 493, 1048
BstMWI GCNNNNNNNGC 1 cut(s) 34
BstNSI RCATGY 3 cut(s) 41, 710, 761
BstSFI CTRYAG 1 cut(s) 966
BstV1I GCAGC 2 cut(s) 661, 763
BstV2I GAAGAC 1 cut(s) 915
BstXI CCANNNNNNTGG 1 cut(s) 94
BtsCI GGATG 5 cut(s) 432, 474, 643, 892, 1129
BtsIMutI CAGTG 1 cut(s) 334
Cac8I GCNNGC 1 cut(s) 310
CciI TCATGA 3 cut(s) 231, 274, 1208
Cfr13I GGNCC 1 cut(s) 1062
Csp6I GTAC 2 cut(s) 693, 1072
CviQI GTAC 2 cut(s) 693, 1072
DdeI CTNAG 2 cut(s) 9, 953
DpnI GATC 3 cut(s) 413, 495, 1050
DpnII GATC 3 cut(s) 411, 493, 1048
Eam1104I CTCTTC 2 cut(s) 693, 786
EarI CTCTTC 2 cut(s) 693, 786
Ecl136II GAGCTC 1 cut(s) 312
Eco24I GRGCYC 1 cut(s) 314
Eco47I GGWCC 1 cut(s) 1062
Eco53kI GAGCTC 1 cut(s) 312
Eco57I CTGAAG 3 cut(s) 102, 717, 1094
Eco72I CACGTG 1 cut(s) 923
EcoICRI GAGCTC 1 cut(s) 312
EcoT22I ATGCAT 3 cut(s) 358, 432, 474
EcoT38I GRGCYC 1 cut(s) 314
FalI AAGNNNNNCTT 2 cut(s) 755, 787
FaqI GGGAC 1 cut(s) 768
FauNDI CATATG 2 cut(s) 142, 729
FbaI TGATCA 3 cut(s) 411, 493, 1048
FblI GTMKAC 1 cut(s) 767
Fnu4HI GCNGC 2 cut(s) 675, 777
FokI GGATG 5 cut(s) 439, 481, 650, 879, 1116
FriOI GRGCYC 1 cut(s) 314
Fsp4HI GCNGC 2 cut(s) 675, 777
FspBI CTAG 1 cut(s) 171
GluI GCNGC 2 cut(s) 675, 777
GsaI CCCAGC 2 cut(s) 264, 1098
HindIII AAGCTT 3 cut(s) 119, 221, 1151
HinfI GANTC 5 cut(s) 299, 804, 874, 994, 1205
HphI GGTGA 2 cut(s) 934, 1043
Hpy166II GTNNAC 1 cut(s) 768
Hpy188I TCNGA 2 cut(s) 1125, 1138
Hpy188III TCNNGA 7 cut(s) 176, 232, 275, 463, 491, 719, 1209
Hpy8I GTNNAC 1 cut(s) 768
HpyAV CCTTC 3 cut(s) 256, 608, 1075
HpyCH4III ACNGT 1 cut(s) 338
HpyCH4IV ACGT 2 cut(s) 922, 1041
HpyF10VI GCNNNNNNNGC 1 cut(s) 34
HpyF3I CTNAG 2 cut(s) 9, 953
HpySE526I ACGT 2 cut(s) 922, 1041
Ksp22I TGATCA 3 cut(s) 411, 493, 1048
Kzo9I GATC 3 cut(s) 411, 493, 1048
LguI GCTCTTC 1 cut(s) 786
LmnI GCTCC 2 cut(s) 446, 733
LpnPI CCDG 7 cut(s) 80, 246, 504, 579, 1002, 1097, 1108
Lsp1109I GCAGC 2 cut(s) 661, 763
LweI GCATC 4 cut(s) 170, 417, 459, 1138
MaeI CTAG 1 cut(s) 171
MaeII ACGT 2 cut(s) 922, 1041
MaeIII GTNAC 2 cut(s) 110, 209
MalI GATC 3 cut(s) 413, 495, 1050
MboI GATC 3 cut(s) 411, 493, 1048
MboII GAAGA 9 cut(s) 361, 586, 663, 710, 773, 920, 976, 1100, 1205
MhlI GDGCHC 1 cut(s) 314
MmeI TCCRAC 2 cut(s) 108, 615
MnlI CCTC 7 cut(s) 8, 459, 955, 1071, 1119, 1154, 1195
Mph1103I ATGCAT 3 cut(s) 358, 432, 474
MseI TTAA 5 cut(s) 123, 219, 528, 831, 927
MslI CAYNNNNRTG 1 cut(s) 435
MspCI CTTAAG 2 cut(s) 122, 830
Mva1269I GAATGC 3 cut(s) 10, 58, 358
MwoI GCNNNNNNNGC 1 cut(s) 34
NdeI CATATG 2 cut(s) 142, 729
NdeII GATC 3 cut(s) 411, 493, 1048
NlaIV GGNNCC 1 cut(s) 448
NmuCI GTSAC 1 cut(s) 209
NsiI ATGCAT 3 cut(s) 358, 432, 474
NspI RCATGY 3 cut(s) 41, 710, 761
PagI TCATGA 3 cut(s) 231, 274, 1208
PciI ACATGT 1 cut(s) 757
PciSI GCTCTTC 1 cut(s) 786
PctI GAATGC 3 cut(s) 10, 58, 358
PfeI GAWTC 5 cut(s) 299, 804, 874, 994, 1205
PkrI GCNGC 2 cut(s) 676, 778
PmaCI CACGTG 1 cut(s) 923
PmlI CACGTG 1 cut(s) 923
Ppu21I YACGTR 1 cut(s) 923
PscI ACATGT 1 cut(s) 757
PsiI TTATAA 1 cut(s) 1104
Psp124BI GAGCTC 1 cut(s) 314
PspCI CACGTG 1 cut(s) 923
PspFI CCCAGC 2 cut(s) 260, 1094
PspN4I GGNNCC 1 cut(s) 448
PspPI GGNCC 1 cut(s) 1062
PstI CTGCAG 1 cut(s) 970
RsaI GTAC 2 cut(s) 694, 1073
RsaNI GTAC 2 cut(s) 693, 1072
RseI CAYNNNNRTG 1 cut(s) 435
SacI GAGCTC 1 cut(s) 314
SapI GCTCTTC 1 cut(s) 786
SaqAI TTAA 5 cut(s) 123, 219, 528, 831, 927
SatI GCNGC 2 cut(s) 675, 777
Sau3AI GATC 3 cut(s) 411, 493, 1048
Sau96I GGNCC 1 cut(s) 1062
SduI GDGCHC 1 cut(s) 314
SfaNI GCATC 4 cut(s) 170, 417, 459, 1138
SfcI CTRYAG 1 cut(s) 966
SinI GGWCC 1 cut(s) 1062
SmiMI CAYNNNNRTG 1 cut(s) 435
SmlI CTYRAG 3 cut(s) 122, 513, 830
SmoI CTYRAG 3 cut(s) 122, 513, 830
SspI AATATT 1 cut(s) 48
SspMI CTAG 1 cut(s) 171
SstI GAGCTC 1 cut(s) 314
TaaI ACNGT 1 cut(s) 338
TaiI ACGT 2 cut(s) 925, 1044
TaqI TCGA 1 cut(s) 462
TatI WGTACW 2 cut(s) 692, 1071
TfiI GAWTC 5 cut(s) 299, 804, 874, 994, 1205
Tru1I TTAA 5 cut(s) 123, 219, 528, 831, 927
Tru9I TTAA 5 cut(s) 123, 219, 528, 831, 927
TscAI CASTG 1 cut(s) 341
TseFI GTSAC 1 cut(s) 209
TseI GCWGC 2 cut(s) 674, 776
Tsp45I GTSAC 1 cut(s) 209
TspDTI ATGAA 5 cut(s) 17, 263, 773, 866, 921
TspGWI ACGGA 1 cut(s) 1122
TspRI CASTG 1 cut(s) 341
Vha464I CTTAAG 2 cut(s) 122, 830
VpaK11BI GGWCC 1 cut(s) 1062
XapI RAATTY 1 cut(s) 265
XceI RCATGY 3 cut(s) 41, 710, 761
XmiI GTMKAC 1 cut(s) 767
XspI CTAG 1 cut(s) 171
Zsp2I ATGCAT 3 cut(s) 358, 432, 474
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.