Rmu_sc0000718.1_g000024

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000718.1
Physical Location & Seq
Forward (+)
103547 .. 103951
405 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000718.1_g000024.1.cds

Sequence Viewer

Length: 405 bp
atgcttaagttctatcgtaattgcttgaatgataaagctggagaagaaatttggcctcctgatgatggggaatggttggatttggatggtgaaacctattgtcgagttgttagaggatttcttgataacaaaaatgtgaaagagttggcaactttgattattaaagctcagaagctaaagtcttctacaattgtggttgatagattatgttgttgcggtattgttattgcttgtgttggtattgaattttcagataaaaaacacaacattcttgatgaagtgaatgctcagggaggtattttggggcgtgatgtgcatgtgccaatattgaatgctctttgcaaagagcgtagaattgctgaagccactcaaatgtttatggatattagtaactcggagccttga

Protein Analysis

134

Amino Acids

15.06

Weight (kDa)

5.19

Isoelectric Point (pI)

33.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 216
AcsI RAATTY 2 cut(s) 48, 245
AcuI CTGAAG 1 cut(s) 381
AfiI CCNNNNNNNGG 1 cut(s) 65
AflII CTTAAG 1 cut(s) 5
AgsI TTSAA 3 cut(s) 28, 245, 331
AluBI AGCT 3 cut(s) 38, 167, 175
AluI AGCT 3 cut(s) 38, 167, 175
AoxI GGCC 1 cut(s) 53
ApoI RAATTY 2 cut(s) 48, 245
AsuHPI GGTGA 1 cut(s) 101
BbsI GAAGAC 1 cut(s) 174
BccI CCATC 2 cut(s) 59, 80
BfrI CTTAAG 1 cut(s) 5
BmiI GGNNCC 1 cut(s) 399
BpiI GAAGAC 1 cut(s) 174
BpmI CTGGAG 1 cut(s) 60
Bpu10I CCTNAGC 1 cut(s) 288
Bsc4I CCNNNNNNNGG 1 cut(s) 65
BseGI GGATG 1 cut(s) 91
BseLI CCNNNNNNNGG 1 cut(s) 65
BseMII CTCAG 2 cut(s) 182, 302
BshFI GGCC 1 cut(s) 55
BslI CCNNNNNNNGG 1 cut(s) 65
BsmI GAATGC 2 cut(s) 289, 337
BsnI GGCC 1 cut(s) 55
BspACI CCGC 1 cut(s) 216
BspANI GGCC 1 cut(s) 55
BspCNI CTCAG 2 cut(s) 181, 301
BspLI GGNNCC 1 cut(s) 399
BspTI CTTAAG 1 cut(s) 5
BstAFI CTTAAG 1 cut(s) 5
BstDEI CTNAG 2 cut(s) 168, 288
BstF5I GGATG 1 cut(s) 91
BstMWI GCNNNNNNNGC 1 cut(s) 313
BstNSI RCATGY 1 cut(s) 320
BstV2I GAAGAC 1 cut(s) 174
BsuRI GGCC 1 cut(s) 55
BtsCI GGATG 1 cut(s) 91
CviAII CATG 1 cut(s) 317
CviJI RGCY 6 cut(s) 38, 55, 167, 175, 365, 400
CviKI_1 RGCY 6 cut(s) 38, 55, 167, 175, 365, 400
DdeI CTNAG 2 cut(s) 168, 288
Eco57I CTGAAG 1 cut(s) 381
FaeI CATG 1 cut(s) 320
FaiI YATR 3 cut(s) 208, 318, 380
FatI CATG 1 cut(s) 316
FokI GGATG 1 cut(s) 98
GsuI CTGGAG 1 cut(s) 60
HaeIII GGCC 1 cut(s) 55
Hin1II CATG 1 cut(s) 320
HphI GGTGA 1 cut(s) 101
Hpy188I TCNGA 3 cut(s) 171, 253, 397
Hpy188III TCNNGA 3 cut(s) 59, 122, 272
HpyCH4V TGCA 2 cut(s) 316, 342
HpyF10VI GCNNNNNNNGC 1 cut(s) 313
HpyF3I CTNAG 2 cut(s) 168, 288
Hsp92II CATG 1 cut(s) 320
LmnI GCTCC 1 cut(s) 397
LpnPI CCDG 3 cut(s) 24, 72, 275
MaeIII GTNAC 1 cut(s) 389
MboII GAAGA 2 cut(s) 56, 174
MfeI CAATTG 1 cut(s) 189
MluCI AATT 5 cut(s) 19, 48, 189, 245, 354
MmeI TCCRAC 1 cut(s) 57
MnlI CCTC 3 cut(s) 66, 107, 287
MseI TTAA 2 cut(s) 6, 162
MslI CAYNNNNRTG 1 cut(s) 371
MspCI CTTAAG 1 cut(s) 5
MunI CAATTG 1 cut(s) 189
Mva1269I GAATGC 2 cut(s) 289, 337
MwoI GCNNNNNNNGC 1 cut(s) 313
NlaIII CATG 1 cut(s) 320
NlaIV GGNNCC 1 cut(s) 399
NspI RCATGY 1 cut(s) 320
PctI GAATGC 2 cut(s) 289, 337
PspN4I GGNNCC 1 cut(s) 399
RseI CAYNNNNRTG 1 cut(s) 371
SaqAI TTAA 2 cut(s) 6, 162
SetI ASST 5 cut(s) 40, 98, 169, 177, 298
SmiMI CAYNNNNRTG 1 cut(s) 371
SmlI CTYRAG 1 cut(s) 5
SmoI CTYRAG 1 cut(s) 5
Sse9I AATT 5 cut(s) 19, 48, 189, 245, 354
SsiI CCGC 1 cut(s) 216
SspI AATATT 1 cut(s) 327
TaqI TCGA 1 cut(s) 103
TasI AATT 5 cut(s) 19, 48, 189, 245, 354
Tru1I TTAA 2 cut(s) 6, 162
Tru9I TTAA 2 cut(s) 6, 162
TspDTI ATGAA 1 cut(s) 291
Vha464I CTTAAG 1 cut(s) 5
XapI RAATTY 2 cut(s) 48, 245
XceI RCATGY 1 cut(s) 320
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.